Agrobacterium tumefaciens-Mediated Genetic Engineering of Green Microalgae, Chlorella vulgaris

Summary

This protocol outlines the utilization of Agrobacterium tumefaciens-mediated transformation (AMT) for integrating gene(s) of interest into the nuclear genome of the green microalgae Chlorella vulgaris, leading to the production of stable transformants.

Abstract

Agrobacterium tumefaciens-mediated transformation (AMT) serves as a widely employed tool for manipulating plant genomes. However, A. tumefaciens exhibit the capacity for gene transfer to a diverse array of species. Numerous microalgae species lack well-established methods for reliably integrating genes of interest into their nuclear genome. To harness the potential benefits of microalgal biotechnology, simple and efficient genome manipulation tools are crucial. Herein, an optimized AMT protocol is presented for the industrial microalgae species Chlorella vulgaris, utilizing the reporter green fluorescent protein (mGFP5) and the antibiotic resistance marker for Hygromycin B. Mutants are selected through plating on Tris-Acetate-Phosphate (TAP) media containing Hygromycin B and cefotaxime. Expression of mGFP5 is quantified via fluorescence after over ten generations of subculturing, indicating the stable transformation of the T-DNA cassette. This protocol allows for the reliable generation of multiple transgenic C. vulgaris colonies in under two weeks, employing the commercially available pCAMBIA1302 plant expression vector.

Introduction

Agrobacterium tumefaciens, a gram-negative soil-borne bacterium, possesses a unique interkingdom gene transfer ability, earning it the title "natural genetic engineer"¹. This bacterium can transfer DNA (T-DNA) from a tumor-inducing plasmid (Ti-Plasmid) into host cells through a Type IV secretion system, resulting in the integration and expression of the T-DNA within the host genome^1,2,3,4. In the natural setting, this process leads to tumor formation in plants, commonly known as crown gall disease. However, Agrobacterium can also transfer T-DNA into various other organisms, including yeast, fungi, algae, sea urchin embryos, and even human cells under laboratory conditions^5,6,7,8.

Exploiting this natural system, Agrobacterium tumefaciens-mediated transformation (AMT) enables the random integration of gene(s) of interest into a host cell's nuclear genome by modifying the T-DNA region of the Ti-plasmid. For this purpose, a widely used AMT plant expression vector is pCAMBIA1302⁹. Researchers can employ simple cloning workflows in E. coli before transferring the desired vector into A. tumefaciens for subsequent transfer to the host of interest.

Green microalgae are eukaryotes that share many similarities with land plants but are highly recalcitrant to genetic modification. However, genetic transformation plays a crucial role in both fundamental and biotechnological research of microalgae. In several microalgae species, particularly Chlamydomonas reinhardtii, genetic transformation via AMT has successfully introduced transgenes such as human interleukin-2 (hIL-2), the severe acute respiratory syndrome coronavirus 2 receptor-binding domain (SARS-CoV-2 RBD), and two antimicrobial peptides (AMPs)^10,11,12,13. Among these, Chlorella vulgaris, a less fastidious and fast-growing green algae species, holds significant potential for the sustainable production of carbohydrates, proteins, nutraceuticals, pigments, and other high-value compounds¹⁴. However, the lack of reliable tools for creating transgenic strains of C. vulgaris hampers its commercial progress. Since there have been only a limited number of published works utilizing AMT in C. vulgaris¹⁵, and given the considerable differences between plant and microalgae cultivation, optimizing the AMT protocol becomes essential.

In this study, researchers inserted green fluorescent protein (mGFP5) downstream of the Cauliflower Mosaic Virus (CamV) 35S promoter and added a histidine tag to use it as a reporter gene for protein expression. Transformants were selected using Hygromycin B, and after subculturing for over twenty generations, the transformation remained stable. The pCAMBIA1302 plasmid employed in this work can be readily adapted to contain any gene of interest. Furthermore, the method and materials presented can be adjusted for other green algae species with an active CamV35S promoter, as this promoter is used for Hygromycin selection.

Protocol

All media and solutions must be autoclaved prior to use unless otherwise stated. All centrifuge tubes, pipette tips, etc., should be sterile or autoclaved before use. For easy reference, the media recipes used in this protocol are listed in Table 1.

1. Preparation of A. tumefaciens electrocompetent cells

1. Inoculate Agrobacterium (AGL-1) into a 25 mL sterile shaker flask of LB media (supplemented with rifampicin, 20 mg/L^-1) from a frozen glycerol stock and grow overnight at 28-30 °C and 150 rpm.
   ​NOTE: The Agrobacterium strain AGL-1 is (see Table of Materials) resistant to rifampicin, ampicillin, chloramphenicol, and streptomycin and can be obtained from several suppliers.
2. The following day, dilute the culture 1,00,000-fold by adding 0.5 µL of the overnight culture to 50 mL autoclaved ultra-pure water and spread 10 µL of this diluted culture on an LB plate, and then incubate at 28-30 °C for 1-3 days.
3. Pick a colony and start a 20 mL overnight culture in LB with rifampicin at 28-30 °C.
4. The next day, inoculate 500 mL LB media (no antibiotic) in a shaker flask with 9 mL of the overnight culture and grow at 28-30 °C until the OD₆₀₀ reaches 0.5.
5. Divide the culture evenly into ten 50 mL centrifuge tubes and chill on ice for 30 min. Pre-cool the centrifuge to 4 °C.
6. Centrifuge the tubes at 4 °C and 4000 x g for 15 min. Subsequently, remove as much supernatant as possible using a pipette and resuspend the pellet in each tube in 50 mL of ice-cold water.
7. Centrifuge the cells at 4 °C and 4000 x g for 15 min. Remove the supernatant and resuspend the pellet in 25 mL of ice-cold water in each tube.
8. Centrifuge the cells at 4 °C and 4000 x g for 15 min. Remove the supernatant and resuspend the pellet in 1 mL of ice-cold 10% (w/v) glycerol in each tube.
9. Combine all tubes into one 50 mL tube and centrifuge the cells at 4 °C and 4000 x g for 15 min. Remove the supernatant and resuspend the pellet in 400 µL ice-cold 10% (w/v) glycerol. The cell concentration should be about 1-3 x 10¹⁰ cells/mL.
10. Distribute the cells as 50 µL aliquots in sterile prechilled microtubes. Freeze in liquid nitrogen and store in a -80 °C freezer.

2. Electroporation of A. tumefaciens

1. Add 50 µL of AGL-1 A. tumefaciens electrocompetent cells into a prechilled 0.1 mm cuvette and add 2 µL of pCAMBIA1302 or similar plasmid (conc 15 ng/µL) (see Table of Materials).
2. Electroporate at 2400 V using an electroporator (200 Ω, capacitance extender 250 µFD, capacitance 25 µFD, exponential decay, see Table of Materials). The time constant should be >4.5 ms for successful electroporation with exponential decay.
3. Immediately add 1 mL of LB media to the cuvette and gently pipette up and down to mix. Transfer the 1 mL of resuspended cells into a 1.5 mL microtube and incubate it at 28-30 °C for at least 1 h to recover.
4. Plate the cells on LB agar containing the appropriate antibiotic (i.e., 50 mg/L of kanamycin for pCAMBIA1302 for prokaryotic selection).
5. Incubate at 28-30 °C for 2-3 days.
6. Select one colony, grow overnight in LB with the appropriate selection (50 mg/L of kanamycin for pCAMBIA1302), and cryopreserve the plasmid-containing strain using 50% glycerol at -80 °C for future use.

3. AMT of C. vulgaris

NOTE: Prepare C. vulgaris (UTEX 395, see Table of Materials) and A. tumefaciens cultures in parallel for co-cultivation. C. vulgaris cultures should be started 3 days before preparing A. tumefaciens cultures. Protocol was modified based on that published by Kumar et al.⁷.

1. Prepare C. vulgaris culture
   1. C. vulgaris is traditionally stored on slants or maintained in log-phase cultures in illuminated conditions. From a log phase culture at OD₆₀₀ = 1.0, spread 0.5 mL onto a Tris-Acetate-Phosphate (TAP, see Table 1) agar plates (1.2% w/v agar A) and grow for 5 days at 25 °C with illumination (50 µE/m²s). This will yield approximately 5 x 10⁶ cells.
2. Prepare A. tumefaciens culture
   1. Grow A. tumefaciens AGL-1 pCAMBIA1302 strain in a shaker flask by inoculating 10 mL of LB media supplemented with 15 mM glucose, 20 mg/L rifampicin, and 50 mg/L kanamycin (see Table of Materials) using the glycerol stock. Incubate at 28-30 °C and 250 rpm overnight.
   2. Inoculate 1 mL of overnight culture into 50 mL of LB with 15 mM glucose, 20 mg/L rifampicin, and 50 mg/L kanamycin and incubate at 28-30 °C and 250 rpm until the OD₆₀₀ reaches 1.0.
3. Cocultivate C. vulgaris and A. tumefaciens
   1. To prepare the A. tumefaciens culture for co-cultivation, transfer the grown culture to a 50 mL tube and centrifuge at 4000 x g for 30 min at room temperature. Remove the supernatant using a pipette and wash the cells twice with the induction medium.
      NOTE: The induction media used is TAP media adjusted to pH 5.5 and supplemented with F/2 medium trace metals and vitamins with 200 µM acetosyringone (AS, see Table of Materials). Resuspend the cells in induction media such that OD₆₀₀ = 0.5.
   2. To prepare the C. vulgaris culture for co-cultivation, add 25 mL of induction media to the C. vulgaris plate containing ~ 5 x 10⁶ cells. Transfer to a 50 mL tube. Centrifuge the cells at 4000 x g for 15 min at room temperature and discard the supernatant.
   3. Mix the algal cell pellet with 200 µL of the bacterial suspension (OD₆₀₀: 0.5) and incubate them in a rotary shaker at 21-25 °C at 150 rpm for 1 h.
   4. Spread the mixed culture (200 µL) onto induction media plates supplemented with 15 mM glucose and incubate at 21-25 °C in the dark for 3 days.
   5. After 3 days, use 10 mL of TAP media supplemented with 400 mg/L cefotaxime or 20 mg/L of tetracycline (see Table of Materials) to collect the microalgae and incubate in the dark at 21-25 °C for 2 days to eliminate A. tumefaciens from the culture.
   6. Plate 500 µL of the culture onto selective media, e.g., TAP media supplemented with 20-70 mg/L of Hygromycin B (when using pCAMBIA1302) and 400 mg/L^-1 cefotaxime or 20 mg/L of tetracycline. Incubate 21-25 °C in the dark for 2 days before placing them in an illuminated chamber.
      NOTE: Resistant colonies will appear 5-7 days after light exposure.
   7. Pick single colonies from the transformation plate and re-streak them on TAP agar plates supplemented with 400 mg/L of cefotaxime or 20 mg/L of tetracycline and 20-70 mg/L of Hygromycin B.

4. Colony PCR (cPCR) to confirm gene integration in C. vulgaris transformants

1. Extract genomic DNA from a C. vulgaris transformant after subculturing at least twice from a single colony using a plant genomic DNA extraction kit (see Table of Materials). Using this as a template for PCR, design primers for the mgfp5 region of the T-DNA (mgfp5-Fwd: 5' CCCATCTCATAAATAACGTC 3', and M13-Rev: 5' CAGGAAACAGCTATGAC 3').
   1. Using a Q5 high-fidelity DNA polymerase master mix kit (see Table of Materials), perform polymerase chain reaction (PCR) to validate transgene integration.
      NOTE: The following conditions were used for the present study: 98 °C for 3 min; 35 cycles (98 °C for 10 s, 57 °C for 30 s, 72 °C for 1 min); 72 °C for 5min. Use pCAMBIA1302 as a positive control and wild-type C. vulgaris genomic DNA as a negative control.
2. To confirm that there is no pCAMBIA1302 present in the sample due to residual contamination by A. tumefaciens, use colony PCR. Add a small amount of transformant cells to 10 µL of sterile water and boil at 98 °C for 15 min. Use this as a template for PCR.
   1. Design primers for a region outside of the T-DNA on pCAMBIA1302 (B1-Fwd: 5'AGTAAAGGAGAAGAACTTTTC 3' and B1-Rev: 5'CCTGATGCGGTATTTTCTC 3').
      NOTE: The following conditions were used for the present study: 94 °C for 3 min; 30 cycles (94 °C for 30 s, 48 °C for 30 s, 68 °C for 5 min); 68 °C for 7 min. Use a boiled colony of A. tumefaciens AGL-1 (pCAMBIA1302) as a positive control and a boiled colony of wild-type C. vulgaris as a negative control.
3. To confirm that there is no A. tumerfaciens contamination present in the sample, use colony PCR. Add a small amount of transformant cells to 10 µL of sterile water and boil at 98 °C for 15 min. Use this as a template for PCR.
   1. Design primers for the virE2 gene contained on the AGL-1 virulence plasmid (virE2-Fwd: 5' AGGGAGCCCTACCCG 3' and virE2-Rev: 5' GAACCAGCCTGGAGTTCG 3').
      NOTE: The following conditions were used for the present study: 94 °C for 3 min; 30 cycles (94 °C for 30 s, 53 °C for 30 s, 68 °C for 3 min); 68 °C for 7 min. Use a boiled colony of A. tumefaciens AGL-1 (pCAMBIA1302) as a positive control and a boiled colony of wild-type C. vulgaris as a negative control.
4. Run PCR samples on a DNA agarose gel along with a ladder (1 Kbp DNA ladder, see Table of Materials) to confirm the size of the resulting fragments¹⁶.

5. Measuring the fluorescence of transformants

1. Inoculate each transformant from a log-phase maintenance culture or TAP agar slant into 50 mL of TAP supplemented with 200 mg/L^-1 cefotaxime and 25 mg/L^-1 Hygromycin B such that the starting OD₆₀₀ = 0.1. Inoculate one culture with wild-type C. vulgaris and only 200 mg/L^-1 cefotaxime as the negative control. Incubate at 25 °C at 150 rpm with 150 µmol/m²s of photosynthetically active light (see Table of Materials).
2. Every 24 h, take a 300 µL of sample and measure the absorbance and fluorescence (excitation 488 nm, emission 526 nm) in a 96-well plate reader or UV/Vis spectrometer and fluorometer (see Table of Materials). Use a black plate with a transparent bottom for simultaneous measurements.

6. Crude protein extraction, protein purification, and SDS-PAGE electrophoresis

1. Inoculate transformant (#50) from a log-phase maintenance culture into 300 mL of TAP supplemented with 200 mg/L^-1 cefotaxime and 25 mg/L^-1 Hygromycin B to reach the OD₆₈₀ = 0.1. Inoculate one culture with wild-type C. vulgaris and only 200 mg/L^-1 cefotaxime as the negative control. Incubate at 25 °C at 150 rpm with 150 µmol/m²s of photosynthetically active light.
2. Extract the crude protein sample from the transformant (#50) and wild-type strains using 5 mL lysis buffer (see Table 1), followed by sonication for 4 min.
3. Purify crude protein sample with a Ni-NTA resin through 5 mL polypropylene columns (see Table of Materials).
4. Lyophilize the 15 mL purified protein samples and resuspend them in 1 mL lysis buffer for SDS-PAGE analysis¹⁷.

Results

To show successful transformation using the method above, C. vulgaris was cocultured with either AGL-1 containing the pCAMBIA1302 plasmid or without the plasmid (wild-type and plated on TAP agar supplemented with Hygromycin B and cefotaxime (Figure 1A). The leftmost plate shows the transformed colonies capable of growth on Hygromycin B/cefotaxime plates, and the middle plate shows that wild-type AGL-1 cannot grow on the Hygromycin B/cefotaxime plates. The rightmost plate shows that ...

Discussion

The efficiency of transformation is associated with several different parameters. The choice of A. tumefaciens strains used for AMT is crucial. AGL-1 is one of the most invasive strains discovered and, for this reason, has been routinely used in plant AMT. Supplementing the induction media with glucose (15-20 mM) is also important for AMT efficiency. Considering C. vulgaris can grow in both phototrophic and heterotrophic conditions, glucose or other carbon sources are often omitted from microalgae media...

Materials

Name	Company	Catalog Number	Comments
1 Kb Plus DNA ladder	FroggaBio	DM015
Acetosyringone	Fisher Scientific	D26665G
Agrobacterium tumefaciens	Gold Biotechnologies	Strain: AGL-1; Gift from Prof. Paul Hooykaas	Genotype: C58 RecA (RifR/CarbR) pTiBo542DT-DNA
Biotin	Enzo Life Sciences	89151-400
CaCl2·2H2O	VWR	BDH9224-1KG
Cefotaxime	AK Scientific	J90010
Chlorella vulgaris	University of Texas at Austin Culture Collection of Algae	Strain: UTEX 395	Wildtype strain
CoCl2·6H2O	Sigma Aldrich	C8661-25G
CuSO4·5H2O	EMD Millipore	CX2185-1
FeCl3·6H2O	VWR	BDH9234-500G
Gene Pulser Xcell Electroporator	Bio-Rad	1652662	Main unit equipped with PC module.
GeneJET Plant Genome Purification Kit	Thermo Scientific	K0791
Glacial acetic acid	VWR	CABDH3093-2.2P
Glycerol	BioBasic	GB0232
HEPES Buffer	Sigma Aldrich	H-3375
Hygromycin B	Fisher Scientific	AAJ6068103
K2HPO4	VWR	BDH9266-500G
Kanamycin	Gold Biotechnologies	K-250-25
KH2PO4	VWR	BDH9268-500G
MgSO4·7H2O	VWR	97062-134
MnCl2·4H2O	JT Baker	BAKR2540-01
Na2CO3	VWR	BDH7971-1
Na2EDTA·2H2O	JT Baker	8993-01
Na2MoO4·2H2O	JT Baker	BAKR3764-01
NaCl	VWR	BDH7257-7
NaH2PO4 H2O	Millipore Sigma	CA80058-650
NaNO3	VWR	BDH4574-500G
NEBExpress Ni Resin	NewEngland BioLabs	NEB #S1427
NH4Cl	VWR	BDH9208-500G
pCAMBIA1302	Leiden University	Gift from Prof. Paul Hooykaas	pBR322, KanR, pVS1, T-DNA(CaMV 35S/HygR/CaMV polyA, CaMV 35S promoter/mgpf5-6xhis/NOS terminator)
Polypropylene Columns (5 mL)	QIAGEN	34964
Precision Plus Protein Unstained Protein Standards, Strep-tagged recombinant, 1 mL	Bio-Rad	1610363
Rifampicin	Millipore Sigma	R3501-1G
SunBlaster LED Strip Light 48 Inch	SunBlaster	210000000906
Synergy 4 Microplate UV/Vis spectrometer	BioTEK	S4MLFPTA
Tetracycline	Thermo Scientific Chemicals	CAAAJ61714-14
TGX Stain-Free FastCast Acrylamide Kit, 12%	Bio-Rad	1610185
Thiamine	TCI America	T0181-100G
Tris Base	Fisher Scientific	BP152-500
Tryptone	BioBasic	TG217(G211)
Vitamin B12 (cyanocobalamin)	Enzo Life Sciences	89151-436
Yeast Extract	BioBasic	G0961
ZnSO4·7H2O	JT Baker	4382-01