The authors are indebted to the chiefs, headmen and communities of Macha for their unwaveing cooperating during mosquito field sample collections. Dr Doug Norris and Rebekah Kent offered invaluable expertise on the salting out protocol. This work was funded by the Johns Hopkins Malaria Research Institute pilot grant system. Mosquito and parasite DNA laboratory standards were kindly donated by MR4, American Type &amp; Culture Collection.

1. Preparatory Dissection of Mosquito Specimens
<ol>
	<li>Place mosquito on a small cutting of parafilm and mount on dissecting microscope.</li>
	<li>Cover in drop of deionized water to soften tissue.</li>
	<li>Incise the mosquito carcass precisely at the joint between the thorax and abdomen, thus nicking off the head and thorax from the abdominal section.</li>
	<li>Transfer each dissected mosquito section into a clean autoclaved 1.5 ml microcentrifuge tube prelabeled with mosquito ID number details and appropriately marked to denote body section (e.g. "m" for mid-gut section; "ht" for head and thorax section).</li>
	<li>Discard parafilm and carefully wipe microscope stage with 70% alcohol-moistened Kimwipe before processing the next mosquito.</li>
</ol>
2. DNA Extraction from Mosquito Specimens
<ol>
	<li>Pipette 20 &mu;l of deionized water into sample tube and use pipette tip to grind the submerged mosquito section into a uniform suspension.</li>
	<li>Add 100 &mu;l of autoclaved 1X PBS/1% saponin solution to sample homogenate and mix by gentle momentary vortexing.</li>
	<li>Incubate at room temperature for 20 min.</li>
	<li>Centrifuge at 20,000 x g for 2 min and discard supernatant.</li>
	<li>Resuspend pellet in 100 &mu;l 1X PBS.</li>
	<li>Centrifuge again at 20,000 x g for 2 min and discard supernatant.</li>
	<li>By gentle vortexing (5 sec), resuspend pellet in 75 &mu;l sterile deionized water and 25 &mu;l of 20% w/v Chelex-100 resin suspension in deionized water.</li>
	<li>Pierce hole in lid of sample tube using sterile 23G hypodermic needle flamed in Bunsen burner.</li>
	<li>Boil sample suspension in water bath on floating rack (or in heating block) for 10 min.</li>
	<li>Centrifuge at 20,000 x g, for 1 min and transfer ensuing DNA solution into prelabeled storage vial for use as template in PCR applications.</li>
</ol>
3. Plasmodium falciparum Genotyping and Anopheles spp. Molecular Identification
<ol>
	<li>Add 2.5 &mu;l of the Chelex DNA extract in 25 &mu;l PCR reactions to check DNA quality11, identify Anopheles species10 and to genotype P. falciparum12mid-gut and salivary gland infections.</li>
	<li>To maximize amplicon yield, especially for P. falciparum detection, include 1.5X bovine serum albumin (BSA) in the PCR assay. The following reaction composition is recommended: (2.5 &mu;l template, 0.25 &mu;M primers, 1.5 &mu;M magnesium chloride, 200 &mu;M dNTPs, 1X PCR Buffer, 1.5X BSA and 1.0U Taq DNA polymerase, in 25 &mu;l volumes).</li>
	<li>To check for DNA quality in extract, amplify region of the arthropod mitochondrial nicotinamide adenine dinucleotide dehydrogenase (NADH) subunit 4 (ND4) gene (primers ND4FW [5'-GTD YAT TTA TGA TTR CCT AA-3'] and ND4RV [5'-CTT CGD CTT CCW ADW CGT TC-3']; expect product 400bp)11,13.</li>
	<li>To differentiate Anopheles gambiae sl. sibling species (An. gambiae ss and An. arabiensis only), amplify region flanking SNPs in the intergenic spacer (IGS) region, (primers UN [5'-GTGTGCCCCTTCCTCGATGT-3'], GA [5'-CTGGTTTGGTCGGCACGTTT-3'], AR [5'-AAGTGTCCTTCTCCATCCTA-3']; expect product 390bp An gambiae ss, 315bp An arabiensis)10,11.</li>
	<li>For typing P. falciparum antifolate drug resistance polymorphisms, perform nested PCR to amplify region flanking amino acid codons 108, 51, 59, 16 and 164 in the parasite dihydrofolate reductase (DHFR) gene: 
	Primary round primers: M1 [5'-TTTATGATGGAACAAGTCTGC-3'] and M5 [5'-AGTATATACATCGCTAACAGA-3'] 
	Secondary round primers: M3 [5'-TTTATGATGGAACAAGTCTGCGACGTT-3'] with F/ [5'-AAATTCTTGATAAACAACGGAAACCTTTTA-3'] 
	Or 
	F [5'-GAAATGTAATTCCCTAGATATGGAATATT-3] with M4 [5'-TTAATTTCCCAAGTAAAACTATTAGAGCTTC-3']). 
	Also amplify region containing amino acid codons 436, 437, 540, 581 and 613 in the P. falciparum dihydropteroate synthetase (DHPS) gene: 
	Primary round primers R2 [5'- AACCTAAACGTGCTGTTCAA-3'] with R/ [5'- AATTGTGTGATTTGTCCACAA3']; 
	Secondary round primers 
	J: [5'-'TGCTAGTGTTATAGATATAGGTGGAGAAAGC-3'] with K/ [5'-CTATAACGAGGTATTGCATTTATTGCAAGAA-3'] 
	Or 
	K: [5'-TGCTAGTGTTATAGATATAGGATGAGCATC-3'] with K/, 
	Or 
	L [5'- ATAGGATACTATTTGATATTGATATTGGACCAGGATTCG-3'] with L/ [5'-5TATTACAACATTTTGATCATTCGCGCAACCGG-3']12.</li>
	<li>Subject 4 &mu;l amplicon to allele-specific restriction enzyme digestions in 30 &mu;l reactions following the manufacturer's instructions, to detect antifolate drug resistance-associated polymorphisms12.</li>
	<li>Subject 5 &mu;l of PCR amplicon (or 15 &mu;l of restriction digest) per lane of ethidium bromide-stained 2% agarose gel to electrophoresis (100 - 120V) and visualize bands under UV transillumination.</li>
</ol>

<ol>
	<li>Bonnet, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficacy+of+antimalarial+treatment+in+Guinea:+in+vivo+study+of+two+artemisinin+combination+therapies+in+Dabola+and+molecular+markers+of+resistance+to+sulphadoxine-pyrimethamine+in+N'Zerekore.">Efficacy of antimalarial treatment in Guinea: in vivo study of two artemisinin combination therapies in Dabola and molecular markers of resistance to sulphadoxine-pyrimethamine in N'Zerekore.</a> Malar. J. 6, 54 (2007).</li><li>Nsimba, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sulphadoxine/pyrimethamine+versus+amodiaquine+for+treating+uncomplicated+childhood+malaria+in+Gabon:+a+randomized+trial+to+guide+national+policy.">Sulphadoxine/pyrimethamine versus amodiaquine for treating uncomplicated childhood malaria in Gabon: a randomized trial to guide national policy.</a> Malar. J. 7, 31 (2008).</li><li>Oyewole, I. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Behaviour+and+population+dynamics+of+the+major+anopheline+vectors+in+a+malaria+endemic+area+in+southern+Nigeria.">Behaviour and population dynamics of the major anopheline vectors in a malaria endemic area in southern Nigeria.</a> J. Vector Borne Dis. 44, 56-64 (2007).</li><li>Harris, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+large+proportion+of+asymptomatic+Plasmodium+infections+with+low+and+sub-microscopic+parasite+densities+in+the+low+transmission+setting+of+Temotu+Province,+Solomon+Islands:+challenges+for+malaria+diagnostics+in+an+elimination+setting.">A large proportion of asymptomatic Plasmodium infections with low and sub-microscopic parasite densities in the low transmission setting of Temotu Province, Solomon Islands: challenges for malaria diagnostics in an elimination setting.</a> Malar. J. . 9, 254 (2010).</li><li>Ouedraogo, A. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Substantial+contribution+of+submicroscopical+Plasmodium+falciparum+gametocyte+carriage+to+the+infectious+reservoir+in+an+area+of+seasonal+transmission.">Substantial contribution of submicroscopical Plasmodium falciparum gametocyte carriage to the infectious reservoir in an area of seasonal transmission.</a> PLoS ONE. 4, e8410 (2009).</li><li>Birx, D., de Souza, M., Nkengasong, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+challenges+in+the+scaling+up+of+HIV,+TB,+and+malaria+programs:+The+interaction+of+health+and+laboratory+systems,+clinical+research,+and+service+delivery.">Laboratory challenges in the scaling up of HIV, TB, and malaria programs: The interaction of health and laboratory systems, clinical research, and service delivery.</a> Am. J. Clin. Pathol. 131, 849-851 (2009).</li><li>Ishengoma, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Health+laboratories+in+the+Tanga+region+of+Tanzania:+the+quality+of+diagnostic+services+for+malaria+and+other+communicable+diseases.">Health laboratories in the Tanga region of Tanzania: the quality of diagnostic services for malaria and other communicable diseases.</a> Ann. Trop. Med. Parasitol. 103, 441-453 (2009).</li><li>Alonso, P. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+research+agenda+for+malaria+eradication:+vector+control.">A research agenda for malaria eradication: vector control.</a> PLoS Med. 8, e1000401 (2011).</li><li>Grimberg, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+and+efficient+non-organic+procedure+for+the+isolation+of+genomic+DNA+from+blood.">A simple and efficient non-organic procedure for the isolation of genomic DNA from blood.</a> Nucleic Acids Res. 17, 8390 (1989).</li><li>Scott, J. A., Brogdon, W. G., Collins, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Indentification+of+single+specimens+of+the+Anopheles+gambiae+complex+by+polymerase+chain+reaction.">Indentification of single specimens of the Anopheles gambiae complex by polymerase chain reaction.</a> American Journal of Tropical Medicine and Hygiene. 49, 520-529 (1993).</li><li>Kent, R. J., Norris, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+mammalian+blood+meals+in+mosquitoes+by+a+multiplexed+polymerase+chain+reaction+targeting+cytochrome+B.">Identification of mammalian blood meals in mosquitoes by a multiplexed polymerase chain reaction targeting cytochrome B.</a> Am. J. Trop. Med. Hyg. 73, 336-342 (2005).</li><li>Duraisingh, M. T., Curtis, J., Warhurst, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmodium+falciparum:+detection+of+polymorphisms+in+the+dihydrofolate+reductase+and+dihydropteroate+synthetase+genes+by+PCR+and+restriction+digestion.">Plasmodium falciparum: detection of polymorphisms in the dihydrofolate reductase and dihydropteroate synthetase genes by PCR and restriction digestion.</a> Exp. Parasitol. 89, 1-8 (1998).</li><li>Gorrochotegui-Escalante, N., Munoz, M. L., Fernandez-Salas, I., Beaty, B. J., Black, W. C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+isolation+by+distance+among+Aedes+aegypti+populations+along+the+northeastern+coast+of+Mexico.">Genetic isolation by distance among Aedes aegypti populations along the northeastern coast of Mexico.</a> Am. J. Trop. Med. Hyg. 62, 200-209 (2000).</li><li>Kreader, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relief+of+amplification+inhibition+in+PCR+with+bovine+serum+albumin+or+T4+gene+32+protein.">Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein.</a> Appl. Environ. Microbiol. 62, 1102-1106 (1996).</li><li>Norris, D. E., Shurtleff, A. C., Toure, Y. T., Lanzaro, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microsatellite+DNA+polymorphism+and+heterozygosity+among+field+and+laboratory+populations+of+Anopheles+gambiae+ss+(Diptera+Culicidae).">Microsatellite DNA polymorphism and heterozygosity among field and laboratory populations of Anopheles gambiae ss (Diptera Culicidae).</a> J. Med. Entomol. 38, 336-340 (2001).</li><li>Schriefer, M. E., Sacci, J. B., Wirtz, R. A., Azad, A. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+polymerase+chain+reaction-amplified+malarial+DNA+in+infected+blood+and+individual+mosquitoes.">Detection of polymerase chain reaction-amplified malarial DNA in infected blood and individual mosquitoes.</a> Exp. Parasitol. 73 (91), 311-316 (1991).</li><li>Al-Soud, W. A., Radstrom, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+and+characterization+of+PCR-inhibitory+components+in+blood+cells.">Purification and characterization of PCR-inhibitory components in blood cells.</a> J. Clin. Microbiol. 39, 485-493 (2001).</li><li>Hyun, C., Filippich, L. J., Hughes, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+inhibitory+effect+of+pentobarbitone+on+reverse+transcription-PCR.">The inhibitory effect of pentobarbitone on reverse transcription-PCR.</a> J. Biochem. Biophys. Methods. 62, 63-68 (2005).</li></ol>

No conflicts of interest declared.

The simplified Chelex method presented here enables extraction of quality Anopheles spp and P. falciparum DNA from mosquito specimens amenable to diverse PCR applications. This technique can be employed for molecular identification of malaria vector mosquitoes and surveillance of drug-resistant P. falciparum alleles in mosquitoes for national malaria control programs. The advantages of the simplified Chelex technique include simplicity, fewer reagents and hence cost, safety and shorter processing time (37 min) than standard protocols such as the salting out method10 (2 hr 47 min and an overnight step, Table 1). The aforementioned advantages and minimal reagent requirements (3 reagents) compared to the current standard protocol (10 reagents, Table 1)11,15, make the simplified Chelex protocol particularly friendly to endemic country laboratories where a constant reagent supply chain is often difficult to maintain. A limitation of the method is that like the standard protocol, it was also subject to PCR inhibitors known to occur in the mosquito integument16. However, this is readily relieved by inclusion of BSA in the assays. BSA has also been successfully employed as an amplification enhancer against inhibitors in other PCR applications17,18.

<table border="1">
 <tbody>
 <tr>
 <td>Name of the reagent</td>
 <td>Company</td>
 <td>Catalogue number</td>
 <td>Comments (optional)</td>
 </tr>
 <tr>
 <td>Chelex-100, 50-100 dry mesh</td>
 <td>BioRad</td>
 <td>#143-2832</td>
 <td></td>
 </tr>
 <tr>
 <td>Saponin</td>
 <td>SIGMA</td>
 <td>142-7425</td>
 <td></td>
 </tr>
 <tr>
 <td>BSA</td>
 <td>New England Biolabs</td>
 <td>B9001S</td>
 <td></td>
 </tr>
 </tbody>
</table>

a simple chelex protocol for dna extraction from anopheles spp.

Endemic countries are increasingly adopting molecular tools for efficient typing, identification and surveillance against malaria parasites and vector mosquitoes, as an integral part of their control programs1,2,3,4,5. For sustainable establishment of these accurate approaches in operations research to strengthen malaria control and elimination efforts, simple and affordable methods, with parsimonious reagent and equipment requirements are essential6,7,8. Here we present a simple Chelex-based technique for extracting malaria parasite and vector DNA from field collected mosquito specimens.
We morphologically identified 72 Anopheles gambiae sl. from 156 mosquitoes captured by pyrethrum spray catches in sleeping rooms of households within a 2,000 km2 vicinity of the Malaria Institute at Macha. After dissection to separate the head and thorax from the abdomen for all 72 Anopheles gambiae sl. mosquitoes, the two sections were individually placed in 1.5 ml microcentrifuge tubes and submerged in 20 &mu;l of deionized water. Using a sterile pipette tip, each mosquito section was separately homogenized to a uniform suspension in the deionized water. Of the ensuing homogenate from each mosquito section, 10 &mu;l was retained while the other 10 &mu;l was transferred to a separate autoclaved 1.5 ml tube. The separate aliquots were subjected to DNA extraction by either the simplified Chelex or the standard salting out extraction protocol9,10. The salting out protocol is so-called and widely used because it employs high salt concentrations in lieu of hazardous organic solvents (such as phenol and chloroform) for the protein precipitation step during DNA extraction9.
Extracts were used as templates for PCR amplification using primers targeting arthropod mitochondrial nicotinamide adenine dinucleotide dehydrogenase (NADH) subunit 4 gene (ND4) to check DNA quality11, a PCR for identification of Anopheles gambiae sibling species10 and a nested PCR for typing of Plasmodium falciparum infection12. Comparison using DNA quality (ND4) PCR showed 93% sensitivity and 82% specificity for the Chelex approach relative to the established salting out protocol. Corresponding values of sensitivity and specificity were 100% and 78%, respectively, using sibling species identification PCR and 92% and 80%, respectively for P. falciparum detection PCR. There were no significant differences in proportion of samples giving amplicon signal with the Chelex or the regular salting out protocol across all three PCR applications. The Chelex approach required three simple reagents and 37 min to complete, while the salting out protocol entailed 10 different reagents and 2 hr and 47 min' processing time, including an overnight step. Our results show that the Chelex method is comparable to the existing salting out extraction and can be substituted as a simple and sustainable approach in resource-limited settings where a constant reagent supply chain is often difficult to maintain.

Examples of results from PCR assays for mosquito DNA extract quality (Figure 1), Anopheles arabiensis molecular identification (Figure 2) and P. falciparum detection (Figure 3) show that the simplified Chelex method yields similar results to the standard salting out protocol10, despite much fewer steps (Table 1). With comparable DNA quality in the respective extracts it is not surprising that sample positivity rates with respect to An. gambiae sibling species as well as parasite infection rates were not statistically different based on McNemar's chi-square test (Figure 3).
Sensitivity (%) was calculated as TP/(TP+FN)*100, where TP denotes true positives and FN denotes false negatives. Specificity (%) was determined as TN/(TN+FP)*100, where TN denotes true negatives and FP denotes false positives. The DNA quality (ND4) PCR showed 93% sensitivity and 82% specificity for the Chelex approach compared to the established salting out protocol as gold standard. Corresponding values of sensitivity and specificity were 100% and 78%, respectively, using sibling species identification PCR and 92% and 80%, respectively for P. falciparum detection PCR.
The addition of BSA to reaction mixtures resulted in a general increase of PCR positives (Figure 3) due to relief of PCR inhibitors14, for both the simplified Chelex and regular salting out protocol. However, this increase was not statistically significant except for DNA quality (ND4 PCR) on Chelex extracts (p = 0.039). Allele-specific restriction enzyme digestion on P. falciparum DHFR (or other target gene) amplicon enables the genotyping of mid-gut and salivary gland malaria infections for drug resistance alleles (Figure 4; salivary gland data not shown).
<table border="1">
 <tbody>
 <tr>
 <td colspan="2">Simple Chelex Procedure</td>
 <td colspan="2">Standard Salting out Procedure</td>
 </tr>
 <tr>
 <td>Steps</td>
 <td>Reagents</td>
 <td>Steps</td>
 <td>Reagents</td>
 </tr>
 <tr>
 <td>
 <ol>
 <li>Add specimen to 1.5 ml microfuge tube and homogenize in 100 &mu;l of 1X PBS/1% Saponin solution (2 min).</li>
 <li>Leave at room temperature for 20 min.</li>
 <li>Spin at 20,000 x g for 2 min and discard supernatant.</li>
 <li>Add 100 &mu;l of 1X PBS and mix gently by momentarily vortexing (3 sec).</li>
 <li>Spin at 20,000 x g for 2 min and discard supernatant.</li>
 <li>Add 25 &mu;l of 20% w/v Chelex in deionized water and 75 &mu;l sterile deionized water.</li>
 <li>Pierce hole in lid of sample tube using hot, sterile 23G hypodermic needle and boil tube contents for 10 min.</li>
 <li>Spin microfuge tube at 20,000 x g for 1 min.</li>
 <li>Transfer supernatant into sterile prelabeled vial and store DNA solution at -20 &deg;C until use (2.5 &mu;l in 25 &mu;l PCR reaction).</li>
 </ol>
 </td>
 <td>
 PBS 
 Saponin 
 Chelex-100 beads </td>
 <td>
 <ol>
 <li>Add specimen to 1.5 ml microfuge tube and homogenize in 100 &mu;l Bender buffer* with 1% DEPC (2 min).</li>
 <li>Incubate at 65 &deg;C for 1 hr.</li>
 <li>Add 15 &mu;l cold 8 M potassium acetate. Mix gently and incubate on ice for 45 min.</li>
 <li>Spin sample in microfuge tubes at 20,000 x g for 10 min and transfer supernatant to a new 1.5 ml tube.</li>
 <li>Add 250 &mu;l of 100% ethanol and mix well by inverting the tube.</li>
 <li>Incubate sample at RT for 5 min.</li>
 <li>Spin samples at 20,000 x g for 15 min.</li>
 <li>Aspirate and discard supernatant, leaving the pellet to dry completely in the tube (30 min).</li>
 <li>Resuspend pellet in 20 &mu;l of 0.1X SSC + RNAse (10 &mu;g/ml) overnight at 4 &deg;C.</li>
 <li>Add 80 &mu;l DEPC water and store at -20 &deg;C until use.</li>
 </ol>
 </td>
 <td>
 Diethylpyrocarbonate (DEPC) 
 *Bender Buffer: 
 0.1 M NaCl 
 0.2 M Sucrose 
 0.1 M Tris-HCL
 
 0.05 M EDTA, pH 9.1 
 0.5% SDS in DEPC water
 8 M Potassium acetate
 Ethanol
 0.1X Saline sodium citrate (SSC) buffer
 RNAse (10 &mu;g/ml)</td>
</tr>
 <tr>
 <td colspan="2">TOTAL TIME: 37 min</td>
 <td colspan="2">TOTAL TIME: 2 hr 47 min, plus overnight</td>
 </tr>
 </tbody>
</table>
Table 1. Step by step comparison of the reagents and time requirements for simple Chelex protocol and standard salting out method for DNA extraction from mosquito specimens.
<img alt="Figure 1" src="/files/ftp_upload/3281/3281fig1.jpg" /> 
 Figure 1. ND4 mitochondrial PCR comparison of DNA quality from simplified Chelex "C" and standard salting out "M" extracts on Anopheles arabiensis field samples. NC, negative control; M1 and C1, M2 and C2, M3 and C3, and M4 and C4 are paired salting out and Chelex extracts from same An. arabiensis mosquito specimens. L, 100 bp DNA ladder.
<img alt="Figure 2" src="/files/ftp_upload/3281/3281fig2.jpg" /> 
 Figure 2. Molecular identification PCR for Anopheles arabiensis. C1 and M1, C2 and M2, C3 and M3, C4 and M4 denote respective amplicon from salting out "M" and simplified Chelex "C" DNA extracts for same mosquito specimens; AR, Anopheles arabiensis positive control; L, 100 bp DNA ladder.
<img alt="Figure 3" src="/files/ftp_upload/3281/3281fig3.jpg" /> 
 Figure 3. Detection of positives on Chelex and salting out DNA extracts for mosquito field samples, with PCR assays for molecular identification of Anopheles arabiensis (AR)10, arthropod NADH dehydrogenase gene 4 (ND4) DNA quality test11, and antifolate drug resistance P. falciparum DHFR genotyping12 (F-M4). Results shown for assays run with or without BSA in the reaction mix. McNemar's chi-square test was used to determine if the differences between percent of positive PCRs from DNA extracted from the simplified Chelex and the standard salting out protocols were statistically significant.
<img alt="Figure 4" src="/files/ftp_upload/3281/3281fig4.jpg" /> 
 Figure 4. Application of simplified Chelex protocol in genotyping P. falciparum infections in mosquitoes (mid-gut data shown) for drug resistance alleles. BstN I digestion on amplicon flanking codon 108 of the P. falciparum DHFR gene12 shows cycloguanil-resistant S108T mutants in mosquito samples (M1-M5; mid-gut data shown). U, undigested 522 bp amplicon; FCR3, laboratory standard P. falciparum positive control clone carrying S108T; K1, P. falciparum laboratory standard clone negative control carrying cycloguanil-sensitive S108N; L, 100 bp DNA ladder.

Watch this Scientific Journal Video about A Simple Chelex Protocol for DNA Extraction from Anopheles spp. at JoVE.com

A Simple Chelex Protocol for DNA Extraction from Anopheles spp.

A rapid and affordable way to extract quality malaria parasite and vector DNA from mosquito specimens is described. Capitalizing on chelating properties of Chelex resin, the simple method enables genotyping of malaria parasites in mosquito mid-gut and salivary gland phases, as well as molecular identification of the Anopheles sibling species by PCR.

A Simple Chelex Protocol for DNA Extraction from Anopheles spp.

Endemic countries are increasingly adopting molecular tools for  efficient typing, identification and surveillance against malaria parasites and  vector ...

a-simple-chelex-protocol-for-dna-extraction-from-anopheles-spp

Research

Education

JoVE Journal

JoVE Core

Biology

Immunology and Infection

Genetics

DNA Structure and Function

SCIENTISTS IN ACTION

54.5K Views.  Malaria Institute at Macha. A rapid and affordable way to extract quality malaria parasite and vector DNA from mosquito specimens is described. Capitalizing on chelating properties of Chelex resin, the simple method enables genotyping of malaria parasites in mosquito mid-gut and salivary gland phases, as well as molecular identification of the Anopheles sibling species by PCR.

Video: A Simple Chelex Protocol for DNA Extraction from Anopheles spp.

A Protocol for Collecting and Staining Hemocytes from the Yellow Fever Mosquito Aedes aegypti

Mosquitoes are vectors for a number of disease-causing pathogens such as the yellow fever virus, malaria parasites and filarial worms. Laboratories are investigating anti-pathogen components of the innate immune system in disease vector species in the hopes of generating transgenic mosquitoes that are refractory to such pathogens1, 2. The innate immune system of mosquitoes consists of several lines of defense 3. Pathogens that manage to escape the barrier imposed by the epithelium-lined mosquito midgut 4 enter the hemolymph and encounter circulating hemocytes, important cellular components that encapsulate and engulf pathogens 5, 6. Researchers have not found evidence for hematopoietic tissues in mosquitoes and current evidence suggests that the number of hemocytes is fixed at adult emergence and numbers may actually decline as the mosquito ages 7. The ability to properly collect and identify hemocytes from medically important insects is an essential step for studies in cellular immunity. However, the small size of mosquitoes and the limited volume of hemolymph pose a challenge to collecting immune cells. 
Two established methods for collecting mosquito hemocytes include expulsion of hemolymph from a cut proboscis 8, and volume displacement (perfusion), in which saline is injected into the membranous necklike region between the head and thorax (i.e., cervix) and the perfused hemolymph is collected from a torn opening in a distal region of the abdomen 9, 10. These techniques, however, are limited by low recovery of hemocytes and possible contamination by fat body cells, respectively 11. More recently a method referred to as high injection/recovery improved recovery of immunocytes by use of anticoagulant buffers while reducing levels of contaminating scales and internal tissues 11. While that method allows for an improved method of collecting and maintaining hemocytes for primary culture, it entails a number of injection and collecting steps that are not necessary if the downstream goal is to collect, fix and stain hemocytes for diagnostics. Here, we demonstrate our method of collecting mosquito hemolymph that combines the simplicity of perfusion, using anticoagulant buffers in place of saline solution, with the accuracy of high injection techniques to isolate clean preparations of hemocytes in Aedes mosquitoes.

A Protocol for Collecting and Staining Hemocytes from the Yellow Fever Mosquito Aedes aegypti

A simplified yet accurate method to collect and stain mosquito hemocytes is described. Our method combines the simplicity of perfusion with the accuracy of high injection techniques to isolate clean preparations of hemocytes in Aedes mosquitoes. This method facilitates studies requiring knowledge of the types of hemocytes and their abundance.

 Mosquitoes are vectors for a number  of disease-causing pathogens such as the yellow fever virus, malaria parasites  and filarial worms. Laboratories are ...

IgY Technology: Extraction of Chicken Antibodies from Egg Yolk by Polyethylene Glycol (PEG) Precipitation

Hens can be immunized by means of i.m. vaccination (Musculus pectoralis, left and right, injection volume 0.5-1.0 ml) or by means of Gene-Gun plasmid-immunization. Dependent on the immunogenicity of the antigen, high antibody-titres (up to 1:100,000 - 1:1,000,000) can be achieved after only one or 3 - 4 boost immunizations. Normally, a hen lays eggs continuously for about 72 weeks, thereafter the laying capacity decreases. This protocol describes the extraction of total IgY from egg yolk by means of a precipitation procedure (PEG. Polson et al. 1980). The method involves two important steps. The first one is the removal of lipids and the second is the precipitation of total IgY from the supernatant of step one. After dialysis against a buffer (normally PBS) the IgY-extract can be stored at -20&deg;C for more than a year. The purity of the extract is around 80 %, the total IgY per egg varies from 40-80 mg, dependent on the age of the laying hen. The total IgY content increases with the age of the hen from around 40 mg/egg up to 80 mg/egg (concerning PEG precipitation). The laying capacity of a hen per year is around 325 eggs. That means a total potential harvest of 20 g total IgY/year based on a mean IgY content of 60 mg total IgY/egg (see Table 1).

IgY Technology: Extraction of Chicken Antibodies from Egg Yolk by Polyethylene Glycol PEG Precipitation

This protocol describes in particular the extraction of total IgY from egg yolk by means of polyethylene glycol precipitation and gives general information about IgY technology.

Hens can be immunized by means of  i.m. vaccination (Musculus pectoralis, left and right, injection volume  0.5-1.0 ml) or by means of Gene-Gun ...

High and Low Throughput Screens with Root-knot Nematodes Meloidogyne spp.

Root-knot nematodes (genus Meloidogyne) are obligate plant parasites. They are extremely polyphagous and considered one of the most economically important plant parasitic nematodes. The microscopic second-stage juvenile (J2), molted once in the egg, is the infective stage. The J2s hatch from the eggs, move freely in the soil within a film of water, and locate root tips of suitable plant species. After penetrating the plant root, they migrate towards the vascular cylinder where they establish a feeding site and initiate feeding using their stylets. The multicellular feeding site is comprised of several enlarged multinuclear cells called 'giant cells' which are formed from cells that underwent karyokinesis (repeated mitosis) without cytokinesis. Neighboring pericycle cells divide and enlarge in size giving rise to a typical gall or root knot, the characteristic symptom of root-knot nematode infection. Once feeding is initiated, J2s become sedentary and undergo three additional molts to become adults. The adult female lays 150-250 eggs in a gelatinous matrix on or below the surface of the root. From the eggs new infective J2s hatch and start a new cycle. The root-knot nematode life cycle is completed in 4-6 weeks at 26-28&deg;C.
Here we present the traditional protocol to infect plants, grown in pots, with root-knot nematodes and two methods for high-throughput assays. The first high-throughput method is used for plants with small seeds such as tomato while the second is for plants with large seeds such as cowpea and common bean. Large seeds support extended seedling growth with minimal nutrient supplement. The first high throughput assay utilizes seedlings grown in sand in trays while in the second assay plants are grown in pouches in the absence of soil. The seedling growth pouch is made of a 15.5 x 12.5cm paper wick, folded at the top to form a 2-cm-deep trough in which the seed or seedling is placed. The paper wick is contained inside a transparent plastic pouch. These growth pouches allow direct observation of nematode infection symptoms, galling of roots and egg mass production, under the surface of a transparent pouch. Both methods allow the use of the screened plants, after phenotyping, for crossing or seed production. An additional advantage of the use of growth pouches is the small space requirement because pouches are stored in plastic hanging folders arranged in racks.

High and Low Throughput Screens with Root-knot Nematodes Meloidogyne spp.

Two distinct methods to screen plants with root-knot nematodes are described. The described approaches include high-throughput screens with nematodes in a nondestructive manner facilitating the use of these plants in breeding programs.

Root-knot nematodes (genus Meloidogyne) are obligate plant parasites. They are extremely polyphagous and considered one of the most economically important ...

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully understood and several hypotheses have been put forward, including mechanical obstruction of microvessels by P. falciparum-parasitized red blood cells (pRBC). Indeed, during the intra-erythrocytic stage of its life cycle, P. falciparum has the unique ability to modify the surface of the infected erythrocyte by exporting surface antigens with varying adhesive properties onto the RBC membrane. This allows the sequestration of pRBC in multiple tissues and organs by adhesion to endothelial cells lining the microvasculature of post-capillary venules 1. By doing so, the mature forms of the parasite avoid splenic clearance of the deformed infected erythrocytes 2 and restrict their environment to a more favorable low oxygen pressure 3. As a consequence of this sequestration, it is only immature asexual parasites and gametocytes that can be detected in peripheral blood.
Cytoadherence and sequestration of mature pRBC to the numerous host receptors expressed on microvascular beds occurs in severe and uncomplicated disease. However, several lines of evidence suggest that only specific adhesive phenotypes are likely to be associated with severe pathological outcomes of malaria. One example of such specific host-parasite interactions has been demonstrated in vitro, where the ability of intercellular adhesion molecule-1 to support binding of pRBC with particular adhesive properties has been linked to development of cerebral malaria 4,5. The placenta has also been recognized as a site of preferential pRBC accumulation in malaria-infected pregnant women, with chondrotin sulphate A expressed on syncytiotrophoblasts that line the placental intervillous space as the main receptor 6. Rosetting of pRBC to uninfected erythrocytes via the complement receptor 1 (CD35)7,8 has also been associated with severe disease 9.
One of the most recently described P. falciparum cytoadherence phenotypes is the ability of the pRBC to form platelet-mediated clumps in vitro. The formation of such pRBC clumps requires CD36, a glycoprotein expressed on the surface of platelets. Another human receptor, gC1qR/HABP1/p32, expressed on diverse cell types including endothelial cells and platelets, has also been shown to facilitate pRBC adhesion on platelets to form clumps 10. Whether clumping occurs in vivo remains unclear, but it may account for the significant accumulation of platelets described in brain microvasculature of Malawian children who died from CM 11. In addition, the ability of clinical isolate cultures to clump in vitro was directly linked to the severity of disease in Malawian 12 and Mozambican patients 13, (although not in Malian 14).
With several aspects of the pRBC clumping phenotype poorly characterized, current studies on this subject have not followed a standardized procedure. This is an important issue because of the known high variability inherent in the assay 15. Here, we present a method for in vitro platelet-mediated clumping of P. falciparum with hopes that it will provide a platform for a consistent method for other groups and raise awareness of the limitations in investigating this phenotype in future studies. Being based in Malawi, we provide a protocol specifically designed for a limited resource setting, with the advantage that freshly collected clinical isolates can be examined for phenotype without need for cryopreservation.

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

This method investigates the platelet-mediated clumping phenotype of Plasmodium falciparum-infected erythrocytes (pRBC) in clinical isolates. This is performed by isolating and co-incubating platelet-rich plasma and a suspension of pRBC.

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully ...

A Simple and Rapid Protocol to Non-enzymatically Dissociate Fresh Human Tissues for the Analysis of Infiltrating Lymphocytes

The ability of malignant cells to evade the immune system, characterized by tumor escape from both innate and adaptive immune responses, is now accepted as an important hallmark of cancer. Our research on breast cancer focuses on the active role that tumor infiltrating lymphocytes play in tumor progression and patient outcome. Toward this goal, we developed a methodology for the rapid isolation of intact lymphoid cells from normal and abnormal tissues in an effort to evaluate them proximate to their native state. Homogenates prepared using a mechanical dissociator show both increased viability and cell recovery while preserving surface receptor expression compared to enzyme-digested tissues. Furthermore, enzymatic digestion of the remaining insoluble material did not recover additional CD45+ cells indicating that quantitative and qualitative measurements in the primary homogenate likely genuinely reflect infiltrating subpopulations in the tissue fragment. The lymphoid cells in these homogenates can be easily characterized using immunological (phenotype, proliferation, etc.) or molecular (DNA, RNA and/or protein) approaches. CD45+ cells can also be used for subpopulation purification, in vitro expansion or cryopreservation. An additional benefit of this approach is that the primary tissue supernatant from the homogenates can be used to characterize and compare cytokines, chemokines, immunoglobulins and antigens present in normal and malignant tissues. This protocol functions extremely well for human breast tissues and should be applicable to a wide variety of normal and abnormal tissues.

This protocol describes the rapid non-enzymatic dissociation of fresh human tissue fragments for qualitative and quantitative assessment of CD45+ cells (lymphocytes/leukocytes) present in various normal and malignant human tissues. Additionally, the supernatant obtained from the primary tissue homogenate can be collected and stored for further analysis or experimentation.

The ability of malignant cells to evade the immune system, characterized by tumor escape from both innate and adaptive immune responses, is now accepted ...

A Simple and Efficient Approach to Construct Mutant Vaccinia Virus Vectors

The CRISPR-associated endonuclease Cas9 can edit particular genomic loci directed by a single guide RNA (gRNA). The CRISPR/Cas9 system has been successfully employed for editing genomes of various organisms. Here we describe a protocol for editing the vaccinia virus (VV) genome in the cytoplasm of VV-infected CV-1 cells using the RNA-guided Cas9. RNA-guided Cas9 induces double-stranded DNA breaks facilitating homologous recombination efficiently and specifically in the targeted site of VV and a transgene can be incorporated into these sites by homologous recombination. By using a site-specific homologous vector with transgene(s), a N1L gene-deleted VV with the red fluorescence protein (RFP) gene incorporated in this region was generated with a successful recombination efficiency 10 times greater than that obtained from the conventional homologous recombination method. This protocol demonstrates successful use of RNA-guided Cas9 system to generate mutant VVs with enhanced efficiency.

Vaccinia virus (VV) has been widely used in biomedical research and the improvement of human health. This article describes a simple, highly efficient method to edit the VV genome using a CRISPR-Cas9 system.

The CRISPR-associated endonuclease Cas9 can edit particular genomic loci directed by a single guide RNA (gRNA). The CRISPR/Cas9 system has been ...

Combining Analysis of DNA in a Crude Virion Extraction with the Analysis of RNA from Infected Leaves to Discover New Virus Genomes

This metagenome approach is used to identify plant viruses with circular DNA genomes and their transcripts. Often plant DNA viruses that occur in low titers in their host or cannot be mechanically inoculated to another host are difficult to propagate to achieve a greater titer of infectious material. Infected leaves are ground in a mild buffer with optimal pH and ionic composition recommended for purifying most bacilliform Para retroviruses. Urea is used to break up inclusion bodies that trap virions and to dissolve cellular components. Differential centrifugation provides further separation of virions from plant contaminants. Then proteinase K treatment removes the capsids. Then the viral DNA is concentrated and used for next-generation sequencing (NGS). The NGS data are used to assemble contigs which are submitted to NCBI-BLASTn to identify a subset of virus sequences in the generated dataset. In a parallel pipeline, RNA is isolated from infected leaves using a standard column-based RNA extraction method. Then ribosome depletion is carried out to enrich for a subset of mRNA and virus transcripts. Assembled sequences derived from RNA sequencing (RNA-seq) were submitted to NCBI-BLASTn to identify a subset of virus sequences in this dataset. In our study, we identified two related full-length badnavirus genomes in the two datasets. This method is preferred to another common approach which extracts the aggregate population of small RNA sequences to reconstitute plant virus genomic sequences. This latter metagenomic pipeline recovers virus related sequences that are retro-transcribing elements inserted into the plant genome. This is coupled to biochemical or molecular assays to further discern the actively infectious agents. The approach documented in this study, recovers sequences representative of replicating viruses that likely indicate active virus infection.

Here we present a new approach to identify plant viruses with double-strand DNA genomes. We use standard methods to extract DNA and RNA from infected leaves and carry out next-generation sequencing. Bioinformatic tools assemble sequences into contigs, identify contigs representing virus genomes and assign genomes to taxonomic groups.

This metagenome approach is used to identify plant viruses with circular DNA genomes and their transcripts. Often plant DNA viruses that occur in low ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for the rapid bedside inactivation of the Ebola virus during blood sampling for safe nucleic acid (NA) tests by adding a commercial lysis/binding buffer directly into the vacuum blood collection tubes. Using this bedside inactivation approach, we have developed a safe, rapid, and simplified bedside NA extraction method for the subsequent detection of a virus in lysis/binding buffer-inactivated whole blood. The NA extraction is directly performed in the blood collection tubes and requires no equipment or electricity. 
After the blood is collected into the lysis/binding buffer, the contents are mixed by flipping the tube by hand, and the mixture is incubated for 20 min at room temperature. Magnetic glass particles (MGPs) are added to the tube, and the contents are mixed by flipping the collection tube by hand. The MGPs are then collected on the side of the blood collection tube using a magnetic holder or a magnet and a rubber band. The MGPs are washed three times, and after the addition of elution buffer directly into the collection tube, the NAs are ready for NA tests, such as qPCR or isothermal loop amplification (LAMP), without the removal of the MGPs from the reaction. The NA extraction method is not dependent on any laboratory facilities and can easily be used anywhere (e.g., in field hospitals and hospital isolation wards). When this NA extraction method is combined with LAMP and a portable instrument, a diagnosis can be obtained within 40 min of the blood collection.

Here, we present a protocol for the rapid virus nucleic acid extraction from the virus-inactivated whole blood. The extraction is performed directly in the blood collection tubes and requires no equipment or electricity. The method is not dependent on laboratory facilities and can be used anywhere (e.g., in field hospitals).

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella spp./Shigella spp. The gold standard method for the detection of Salmonella spp./Shigella spp. is direct culture but this is labor-intensive and time-consuming. Here, we describe a high-throughput platform for Salmonella spp./Shigella spp. screening, using real-time polymerase chain reaction (PCR) combined with guided culture. There are two major stages: real-time PCR and the guided culture. For the first stage (real-time PCR), we explain each step of the method: sample collection, pre-enrichment, DNA extraction and real-time PCR. If the real-time PCR result is positive, then the second stage (guided culture) is performed: selective culture, biochemical identification and serological characterization. We also illustrate representative results generated from it. The protocol described here would be a valuable platform for the rapid, specific, sensitive and high-throughput screening of Salmonella spp./Shigella spp.

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Salmonella spp./Shigella spp. are common pathogens attributed to diarrhea. Here, we describe a high-throughput platform for the screening of Salmonella spp./Shigella spp. using real-time PCR combined with guided culture.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella ...

Analysis of Fecal Microbiota Dynamics in Lupus-Prone Mice Using a Simple, Cost-Effective DNA Isolation Method

Gut microbiota has an important role in educating the immune system. This relationship is extremely important for understanding autoimmune diseases that are not only driven by genetic factors, but also environmental factors that can trigger the onset and/or worsen the disease course. A previously published study on the dynamics of the gut microbiota in lupus-prone MRL/lpr female mice showed how changes of the gut microbiota can alter disease progression. Here, a protocol is described for extracting representative samples from the gut microbiota for studies of autoimmunity. Microbiota samples are collected from the anus and processed, from which the DNA is extracted using a phenol-chloroform method and purified by alcohol precipitation. After PCR is performed, purified amplicons are sequenced using a Next Generation Sequencing platform at Argonne National Laboratory. Finally, the 16S ribosomal RNA gene sequencing data is analyzed. As an example, data obtained from gut microbiota comparisons of MRL/lpr mice with or without CX3CR1 are shown. Results showed significant differences in genera containing pathogenic bacteria such as those in the phylum Proteobacteria, as well as the genus Bifidobacterium, which is considered part of the healthy commensal microbiota. In summary, this simple, cost-effective DNA isolation method is reliable and can help the investigation of gut microbiota changes associated with autoimmune diseases.

This protocol provides a simple, cost-effective DNA isolation method for the analysis of murine gut microbiota alterations during the development of autoimmune disease.

Gut microbiota has an important role in educating the immune system. This relationship is extremely important for understanding autoimmune diseases that ...