Isolation of Mouse Pancreatic Endothelial Cells

Summary

This protocol describes the isolation of mouse endothelial cells from whole pancreas.

Abstract

The pancreas is a vital organ for maintaining metabolic balance within the body, in part due to its production of metabolic hormones such as insulin and glucagon, as well as digestive enzymes. The pancreas is also a highly vascularized organ, a feature facilitated by the intricate network of pancreatic capillaries. This extensive capillary network is made up of highly fenestrated endothelial cells (ECs) important for pancreas development and function. Accordingly, the dysfunction of ECs can contribute to that of the pancreas in diseases like diabetes and cancer. Thus, researching the function of pancreatic ECs (pECs) is important not only for understanding pancreas biology but also for developing its pathologies. Mouse models are valuable tools to study metabolic and cardiovascular diseases. However, there has not been an established protocol with sufficient details described for the isolation of mouse pECs due to the relatively small population of ECs and the abundant digestive enzymes potentially released from the acinar tissue that can lead to cell damage and, thus, low yield. To address these challenges, we devised a protocol to enrich and recover mouse pECs, combining gentle physical and chemical dissociation and antibody-mediated selection. The protocol presented here provides a robust method to extract intact and viable ECs from the whole mouse pancreas. This protocol is suitable for multiple downstream assays and may be applied to various mouse models.

Introduction

The pancreas, key to metabolic control and homeostasis, is a highly vascularized organ. The pancreas has both endocrine and exocrine functions, controlling the regulation of blood glucose and digestive enzymes, respectively. These two compartments are linked together by the extensive network of pancreatic blood vessels, facilitating the exchange and transport of oxygen, hormones, and enzymes. Critically, this dense capillary network penetrates the Islet of Langerhans, a cluster of hormone-regulating cells within the pancreas responsible for its endocrine function, consisting of the glucagon-secreting alpha (α) cells, the insulin-secreting beta (β) cells and the somatostatin-secreting delta (δ) cells^1,2. Although the islets only make up 1-2% of the pancreatic mass, they receive 20% of total blood flow³, highlighting the importance of islet vasculature. The pancreatic capillaries are primarily made up of highly fenestrated endothelial cells (ECs), which are surrounded by mural pericytes. These capillary ECs play a vital role in the islet development, maturation, and (dys)function and form intimate crosstalks with various endo- and exocrine cells⁴ (Figure 1).

Endothelial dysfunction has been observed in both Type 1 and Type 2 diabetes, the most common conditions caused by pancreatic islet dysfunction^5,6. Both islet microvascular density and morphology can be altered in diabetes⁷. Moreover, pancreatic cancer, a highly aggressive tumor that can also be manifested as diabetes, is characterized by high microvascular density with poor perfusion⁸. Given the pivotal structural and functional roles of ECs in both normal and diseased pancreatic tissue, there is a pertinent need to study the pECs in development, physiology, and pathology to unveil the mechanisms that drive health or diseases.

Numerous protocols have been developed for the isolation of ECs from different murine (e.g., brain^9,10, lung¹¹, heart¹², liver¹³, skeletal muscles¹⁴, and adipose tissues¹⁵) and human (e.g., brain¹⁶, visceral adipose tissue^17,18, peripheral nerves¹⁹, lung^20,21,22, and mesenteric artery²³) tissues. These protocols typically involve the use of enzymatic digestions (e.g., by collagenase, trypsin²⁴, dispase^24,25, and liberase²⁶), followed by an antibody-based enrichment step. Moreover, these protocols tend to rely on extended durations of digestions in high concentrations of enzymes with vigorous agitation at 37 °C (Table 1). Due to the unique features of the pancreas, including that it houses a plethora of endogenous digestive enzymes, these existing protocols cannot be directly applied to isolate pECs. First, the extracellular matrix (ECM) composition of the pancreas is different from other tissues. While collagenase is commonly used for EC isolation, there are multiple subtypes with different tissue-specific dissociation capabilities, thus requiring optimization. Second, and crucial to pEC isolation, the release and activation of pancreatic endogenous enzymes can significantly hinder the isolation process. To this end, caution needs to be taken to minimize the rupture of the exocrine acinar cells (the primary source of zymogens, proteases, and RNase²⁷), which can induce further cell damage and result in low cell viability and overall affect recovery^27,28,29.

To address these challenges, we have adapted methods from existing EC isolation protocols and established a new protocol suitable for EC isolation from mouse pancreases. Specifically, we describe here a workflow (Figure 2) using collagenase Type I (typically implemented for lung EC isolation), lower digestion temperatures and no agitation (to prevent activation of pancreatic zymogens), and DNase^30,31,32 supplementation (to prevent DNA-induced apoptosis and improve cell viability, and an antibody for CD31³³ (PECAM1, a pan-EC marker). The described protocol produces EC populations isolated from mouse pancreas that can be used for gene expression profiling and protein assays.

Protocol

Tissue isolation was performed under the approved study protocol #17010 by the Institutional Animal Care and Use Committee (IACUC) of Beckman Research Institute, City of Hope (Duarte, California, USA). Here, we use Tie-2CreERT2;Rosa26-TdTomato mouse line in C57BL/6 background at 8 - 12 weeks of age. In this line, ECs are labeled with TdTomato when induced with tamoxifen as previously described³⁴. However, this protocol can be adapted for all ages of adult mice with different genotypes and genetic backgrounds.

1. Tissue collection (estimated time: 1-2 h)

NOTE: The time estimate is 15 min/animal, recommended maximum 3 animals pooled per dissociation samples.

1. Euthanize animals by carbon dioxide (CO₂) overdose, followed by secondary confirmation of death. Before dissection, spray the whole body with 70% ethanol (EtOH), completely disinfecting the operating area.
2. Stretch out and secure limbs using pins. Using surgical scissors, make a small midline incision through the skin and peritoneum starting from the lower abdominal area and extending toward the thoracic region.
3. Expose the ribcage by cutting through the diaphragm and lift the ribcage to expose the heart.
4. Insert a needle (25G-30G) connected to a syringe containing ice-cold sterile PBS, into the left ventricle of the heart.
5. Start the perfusion by injecting the PBS through the heart at a rate of 5 - 10 mL/min. Stop after injecting 10 mL, or until the liver and kidneys become discolored.
6. After perfusion, locate the pancreas (below the stomach and attached to the duodenum)³⁵ (Figure 3A) and carefully remove it using dissecting scissors and forceps.
7. Once isolated, transfer pancreas to a 50 mL tube containing 10 mL of ice-cold PBS + 0.2 mg/mL trypsin inhibitor, keep on ice (Figure 3B).
   NOTE: Pancreas from a maximum of 3 mice can be pooled at this step and transferred into 1 tube. Samples can be kept on ice for a maximum time of 2 h.

2. Collagenase preparation (estimated time: 15-30 min)

1. Prepare solutions and buffers as described below.
   1. Dissociation solution: Add collagenase Type I into 50 mL tube to a final concentration of 1 mg/mL in Dulbecco's phosphate buffered saline (DPBS 1x (Ca²⁺, Mg²⁺; see Table of Materials) and 0.001 U/mL DNase I + 0.2 mg/mL Trypsin inhibitor.
   2. Dissociation stop solution: Add phosphate buffered saline (PBS 1x, without Ca²⁺, Mg²⁺; same for all the rest PBS in this protocol; see Table of Materials), 5% Bovine Serum Albumin (BSA), 0.001 U/mL DNase I or DMEM + 10% FBS + 0.001 MU/mL DNase I.
   3. Wash buffer: Add PBS 1x, 0.5% Bovine Serum Albumin (BSA), 0.001 U/mL DNase I + 0.05 mg/mL Trypsin Inhibitor.
2. Dissolve buffers completely and filter through a 0.22 µm filter. Set aside and keep on ice.

3. Digestion (estimated time: 40 min-1 h)

1. Remove pancreas from ice-cold PBS and place on Petri dish on top of ice. Carefully remove excess tissue (e.g., spleen, fat, debris) with surgical scissors and tweezers (Figure 3C).
   NOTE: It is crucial to remove fat, as excess of lipids can interfere with tissue digestion.
2. Transfer the trimmed mouse pancreas to a 5 mL tube containing 1 mL of dissociation solution.
3. Keep tube on ice and mince the pancreatic tissues with dissecting scissors into fine pipettable pieces, e.g. 0.5 mm or 1 mm. Transfer lysate into a 50 mL tube and keep on ice.
4. Add additional pancreas to the 5 mL tube used to initially mince the pancreatic tissue and add additional 1 mL of collagenase. Repeat as necessary for multiple pancreas preparations.
5. Add 2 mL of collagenase solution to the 5 mL tube to remove any residual pancreas tissue and transfer to 50 mL tube. Total collagenase volume should be 5 mL for 3 pancreas or 3 mL for a single pancreas.
6. Once all samples have undergone mechanical dissociation, transfer the 50 mL tubes containing the homogenized tissue lysates to a 37 °C water bath and incubate for 10 min.
   NOTE: Do not vigorously agitate or vortex the tissue mixture during this process as this can cause rupture of acinar tissues and the release of abundant endogenous enzymes and DNA.
7. Remove the tubes from water bath and gently swirl to mix well, and leave in water bath for another 10 min. (Total time: 20 min).
   NOTE: Do not exceed 30 min in 37 °C water bath to avoid over-digestion.
8. Place tubes on ice, and let the homogenate settle by gravity. Once settled, transfer supernatant through a 70 µm filter, and add 5 mL of dissociation stop solution.
9. Add an additional 1 mL of dissociation solution to the remaining pellet and triturate with a 18G needle.
10. Pass the remaining homogenate through the filter and wash with an additional 5 mL of dissociation stop solution.
11. Spin cell suspension at 300 x g for 10 min, at 4 °C. Remove supernatant completely by aspiration and keep cell pellet on ice.
12. Resuspend cell pellet with 1 mL of wash buffer and transfer to a 1.5 mL microcentrifuge tube.
13. Take a small aliquot from the resuspended cell pellet (10 µL) and mix with trypan blue at a 1:1 ratio to count cells using a cell counter and measure viability.

4. Endothelial cell (EC) enrichment (estimated time: 2-3 h)

1. Add 1 µL of anti-CD31-biotin antibody for every 1 x 10⁷ cells counted and incubate for 30 min at 4 °C on a rotator (about 5 µL per 3 pancreas).
2. Add 20 µL of anti-biotin microbeads and incubate for 40 min at 4 °C on a tube rotator.
3. Set up a magnetic stand with the column separator holder and apply the column. Equilibrate column with 3 mL of wash buffer.
4. Add sample to the column and wash with a total of 9 mL wash buffer.
   NOTE: If cell concentration is high, dilute cells with an additional 2 mL of wash buffer in a separate tube. Add 1 mL of sample at a time into the column to prevent the column from clogging.
5. Remove column from column holder and place in a 15 mL tube. Add 5 mL of wash buffer, to the column. Use plunger to push down cells in the column and collect elution (which contains enriched EC).
6. Spin down flow-through and elution/EC fraction at 300 x g for 10 min at 4 °C. Count cells and measure viability as in step 3.13.
7. Validate EC-enrichment via qPCR of flow-through and EC-fractions. Use NK6 Homeobox 1 (Nkx6.1) as a general marker for endocrine cells and platelet and endothelial cell adhesion molecule (Pecam1) as a marker for EC³³. Use 36B4 (Rplp0, acidic ribosomal phosphoprotein p0) as an internal control for gene expression normalization.
   NOTE: Collected samples can be used for protein or RNA analyses at this step.

5. Culturing pECs

1. Prepare M199 medium. Supplement M199 medium to a final concentration of 20% fetal bovine serum (FBS) and 0.1% Penicillin-Streptomycin.
2. Coat a 60 mm cell culture plate with collagen Type I (1 mg/mL in 0.1 M acetic acid) and allow to sit for 30 min at room temperature.
3. Remove collagen Type I and rinse the plate with 1X PBS, twice. Add 2 mL of prepared M199 Media and place cell culture plate in standard cell culture incubator (5% CO₂, 37 °C) for 5 min.
4. Once cells have been isolated, add isolated cells to pre-warmed M199 cell culture plate. Keep cells in culture conditions for approximately 14 days and change media every 2-3 days.

Results

Following this protocol, approximately 2 x 10⁶ live cells can be obtained when pooling 3 mouse pancreases, and 750,000 cells from a single mouse pancreas. To validate the enrichment of EC, we performed the following analyses: 1) quantitative PCR: compared to the flow-through (FT) samples (i.e., the non-CD31 antibody-bound fractions), the EC fractions had significantly higher levels of Pecam1 (encoding CD31) and Kdr (encoding VEGFR2), two EC marker genes³³, and lower le...

Discussion

In this article, we present a protocol for enrichment and isolation of the pECs. Similar to previous EC isolation protocols from other tissues or organs, this protocol consists of three major processes, namely, physical dissociation, enzymatic digestion, and antibody-based EC enrichment. To address the unique challenges in processing the pancreas, we introduced several key adaptations and critical steps within our protocol: 1) a gentle one-step collagenase digestion with a short incubation time, 2) supplementation of hig...

Materials

Name	Company	Catalog Number	Comments
1.5 mL eppendorf	USA Scientific	1615-5500
10 cm dish	Genesee Scientific	25-202
25G needles	BD	305145
2X Taq Pro Universal SYBR qPCR Master Mix	Vazyme	Q712-03-AA
5 mL eppendorf	Thermo Fisher	14282300
6-well plate	Greiner Bio-One	07-000-208
70 µm strainer	Fisher	22-363-548
Anti-CD31-biotin	Miltenyi Biotech	REA784
Bovine serum albumin heat shock treated	Fisher	BP1600-100
CaCl2	Fisher	BP510
Centrifuge	Eppendorf
Collagen Type 1, from calf skin	Sigma Aldrich	C9791	Attachment reagent in the protocol
Collagenase Type 1	Worthington Bio	LS004197
Countess Automatic Cell Counter	Thermo Fisher
DAPI	Thermo Fisher	D1306	immunofluorescence
Disposable Safety Scalpels	Myco Instrumentation	6008TR-10
DNAse I	Roche	260913
D-PBS (Ca2+,Mg2+)	Thermo Fisher	14080055
Ethanol	Fisher	BP2818-4
Fetal bovine serum	Fisher	10437028
Incubator			Kept at 37 °C 5% CO2
LS Columns	Miltenyi Biotech	130-042-401
M199	Sigma	M2520-1L
MACS MultiStand with the QuadroMACS Separator	Miltenyi Biotech	130-042-303
Medium 199	Sigma Aldrich	M2520-10X
Microbeads anti-biotin	Miltenyi Biotech	130-090-485
Microscope	Leica		To assess cell morphology
Molecular Grade Water	Corning	46-000-CM
NaCl	Fisher	S271-1
New Brunswick Innova 44/44R Orbital shaker	Eppendorf
PECAM1 (CD31) Antibody	Abcam	ab56299	immunofluorescence
PECAM1 (CD31) Antibody	R&D Systems	AF3628
Phosphate Buffered Saline (10X) (no Ca2+,no Mg2+)	Genesee Scientific	25-507-XB
Primer 36B4 Forward mouse	IDT		AGATTCGGGATATGCTGTTGGC
Primer 36B4 Revese mouse	IDT		TCGGGTCCTAGACCAGTGTTC
Primer Kdr Forward mouse	IDT		TCCAGAATCCTCTTCCATGC
Primer Kdr Reverse mouse	IDT		AAACCTCCTGCAAGCAAATG
Primer Nkx6.1 Reverse mouse	IDT		CACGGCGGACTCTGCATCACTC
Primer Nxk6.1 Forward mouse	IDT		CTCTACTTTAGCCCCAGCG
Primer PECAM1 Forward mouse	IDT		ACGCTGGTGCTCTATGCAAG
Primer PECAM1 Reverse mouse	IDT		TCAGTTGCTGCCCATTCATCA
RNase ZAP	Thermo Fisher	AM9780
RNase-free water	Takara	RR036B
Sterile 12" long forceps	F.S.T	91100-16
Sterile fine forceps	F.S.T	11050-10
Sterile fine scissors	F.S.T	14061-11
Tissue Culture Dishes 2cm	Genesee Scientific	25-260
TRIzol reagent	Fisher	15596018
Trypan Blue	Corning	MT25900CI
Trypsin Inhibitor	Roche	10109886001
Tween-20
VE-Cadherin Antibody	Abcam	ab33168	immunofluorescence
Waterbath