CRISPR-Cas9 Mediated Gene Deletion in Human Pluripotent Stem Cells Cultured Under Feeder-Free Conditions

Summary

The presented method describes the generation of a CRISPR-mediated gene knockout in the human embryonic stem cell (hESC) line H9, which stably expresses sgRNAs targeting the L2HGDH gene using a highly efficient lentiviral-mediated gene delivery system.

Abstract

The CRISPR-Cas9 system for genome editing has revolutionized gene function studies in mammalian cells, including stem cells. However, the practical application of this technique, particularly in pluripotent stem cells, presents certain challenges, such as being time- and labor-intensive and having low editing efficiency. Here, we describe the generation of a CRISPR-mediated gene knockout in a human embryonic stem cell (hESC) line stably expressing sgRNAs for the L2HGDH gene, using a highly efficient and stable lentiviral-mediated gene delivery system. The sgRNAs targeting exon 1 of the L2HGDH gene were chemically synthesized and cloned into the lentiCRISPR v2-puro vector, which combines the constitutive expression of sgRNAs with Cas9 in a highly efficient single-vector system to achieve higher lentiviral titers for hESC infection and stable selection using puromycin. Puromycin-selected cells were further expanded, and single-cell clones were obtained using the limited dilution method. The single clones were expanded, and several homozygous knockout clones for the L2HGDH gene were obtained, as confirmed by a 100% reduction in L2HGDH expression using Western blot analysis. Furthermore, using MSBSP-PCR, the CRISPR mutation site was mapped upstream of the PAM recognition sequence of Cas9 in the selected homozygous clones. Sanger sequencing was performed to analyze the exact insertions/deletions, and functional characterization of the clones was conducted. This method produced a significantly higher percentage of homozygous deletions compared to previously reported non-viral gene delivery methods. Although this report focuses on the L2HGDH gene, this robust and cost-effective approach can be used to create homozygous knockouts for other genes in pluripotent stem cells for gene function studies.

Introduction

Human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs) are stem cells with the potential to differentiate into all cell types in the body. These cells serve as valuable tools for studying human development, as well as for understanding the underlying mechanisms of various diseases, thus offering tremendous promise for regenerative medicine, disease modeling, and drug discovery. Such studies involve investigating how specific genes contribute to the development, functioning, and regulation of organisms^1,2.

Various techniques and approaches are employed to decipher gene function, including genetic manipulation, such as gene knockout or overexpression, and genome editing. Among these, CRISPR-Cas9 technology has emerged as the most efficient approach for gene knockout and gene editing studies^1,2,3. The CRISPR-Cas9 system works by utilizing a single guide RNA (sgRNA) molecule specifically designed to identify and bind to a particular DNA sequence of interest. Acting as a molecular guide, the sgRNA directs the Cas9 enzyme to the precise location in the genome that requires modification. Once bound, Cas9 initiates a double-stranded break in the DNA at the designated site. Following the cleavage of DNA, the cell's inherent repair mechanisms are activated. These include two main repair pathways: non-homologous end joining (NHEJ) and homology-directed repair (HDR). NHEJ often results in insertions or deletions (indels) at the break site, leading to gene disruption or inactivation. Conversely, HDR enables the insertion of new DNA sequences at the break site, facilitating the introduction of targeted genetic alterations⁴.

Given the importance of gene deletions in pluripotent stem cells, several protocols have been published on CRISPR-Cas9-mediated gene knockouts in hESCs/iPSCs. However, many of these protocols face significant limitations, such as being extremely time-consuming, labor-intensive, and having low efficiency due to the use of non-viral gene delivery methods⁵. These challenges are even more pronounced in hESCs/iPSCs, as these cells are known to have lower editing efficiency compared to other cell types⁵. Some of these limitations can be addressed by increasing the efficiency of plasmid delivery containing Cas9 and sgRNAs. This can be successfully achieved using a lentiviral vector system, which can significantly improve gene editing outcomes. Lentivirus packaging protocols are well-established and straightforward, allowing easy adoption in laboratories, even by researchers with limited experience. Lentiviruses exhibit high infection efficiency across various cell types, including hESCs and iPSCs. Therefore, utilizing a lentiviral system for Cas9-sgRNA expression is ideal for routine gene editing experiments in hESCs/iPSCs for gene function studies.

Here, we provide a simple and straightforward method for highly efficient CRISPR-Cas9-based gene deletions in hESCs in a comparatively shorter time duration than conventional protocols (Figure 1). Although a lentiviral vector with constitutive expression of Cas9 and sgRNA has been used, it could easily be replaced with drug-inducible Cas9 expression for controllable Cas9 expression.

Protocol

The details of the gene sequences, reagents, and equipment used in this study are listed in the Table of Materials.

1. Single guide RNA (sgRNA) design, cloning, and lentiviral vector production

NOTE: Two different sgRNA sequences targeting the exon 1 of the L2HGDH gene, both adapted from Qiu et al.⁶with PAM sites of AGG and TGG for sequences 1 and 2, respectively, are used. Both sgRNAs were 20 bp in length, and ends were modified to add linker sequences for restriction enzyme Bsmb1 to be cloned in the target vector (LentiCRISPRv2) as described in the previous report⁶. Linker sequences were added during the designing of sgRNAs for cloning purposes.

1. Anneal chemically synthesized sgRNAs⁶ and clone into Bsmb1 single cut lentiviral vector, LentiCRISPRv2 using optimized protocol as previously reported⁷.
2. Proceed with lentiviral packaging and concentration using standardized and optimized protocol⁷.
3. For lentivirus production, seed HEK293T cells (1 × 10⁵ cells/cm²) using DMEM, 10% FBS and 1x penicillin/streptomycin (P/S) and incubate overnight in tissue culture incubator at 37 °C in an atmosphere of 5% CO₂ under humid conditions.
4. When 90% confluent, co-transfect HEK293T cells with entry vector (empty backbone or sgRNA expressing plasmids) and packaging plasmids using low-cost cationic polymer PEI as described previously⁷.
5. Collect the conditioned media containing Lentiviral supernatant (LVS) particles at 48 h and 72 h post-transfection and proceed with ultracentrifugation using sucrose cushion and spin the tubes at 1,25,000 x g for 2 h at 4 °C.
6. Proceed with the LVS particle concentration to at least 200 times the original volume in PBS, aliquot, and store at -80 °C until use.
7. Determine the titer of lentiviral particles by using the qPCR Lentivirus Titer Kit following the manufacturer's instructions (see Table of Materials).

2. Lentiviral infections and single-cell clonal propagation

1. For infections with LVS particles, seed hESC (H9) cell suspension having 1 × 10⁵ cells/0.5 mL of hESC culture media (Basal media + P/S + 10 µM of Rock Inhibitor) on complete Matrigel (1:50) coated P24 well plates in 500 µL of media and incubate overnight to allow the cells to attach. Seed extra wells that would not be infected with LVS but treated with puromycin to serve as non-infected control.
   NOTE: Cell counting can be performed using a manual hemocytometer or automated cell counter.
2. The following day, infect the cells at Multiplicity of Infection (MOI) of 10 along with 8 µg/mL of polybrene and incubate at 37 °C for 8 h followed by media replacement with fresh hESC media + P/S without Rock Inhibitor and continue culturing until cells are 90% confluent.
3. Start puromycin selection by supplementing the media with 0.8 µg/mL concentration of puromycin when cells reach 90% confluency, which is usually 48-72 h post-infection, and continue the selection until all cells die in the non-infected cells (control group).
4. After the selection is complete (usually 4-6 days), split stable cells (1:4) and expand for cryopreservation and further analysis.
5. Perform single-cell selection and clonal expansion using cells expressing L2HGDH-sgRNA-1⁶.
6. For this purpose, prepare a cell suspension equivalent to 500 cells/10 mL of complete growth media and seed 100 µL of this suspension in each well of a 96-well plate.
7. Leave the cells undisturbed for 3 days and then observe.
8. Mark the wells that yield single clones and change the media every other day until a sufficient size is achieved for the colonies (usually 2 weeks) to expand further, cryopreserve, and analyze.

3. gDNA extraction, MS-BSP PCR, and Sanger sequencing

1. Isolate gDNA from cells using the genomic DNA isolation Kit following the manufacturer's instructions (see Table of Materials).
2. Proceed with the mapping of mutation sites upstream of the PAM recognition sequences using Mutation Sites Based Specific Primers (MS-BSP) analysis⁸.
3. For this, an unbiased right primer L2H-UMSBSP-R1 is designed to amplify the region outside the Exon1 to amplify any targets.
4. Design a biased left primer L2H-BMSBSP-F1 with an identical sequence to sgRNA to amplify the target sequence close to PAM recognition sequences.
   NOTE: At very high stringent conditions of PCR, the product will be observed on the gel in unmutated clones. No product would be observed in CRISPR-knockout clones exhibiting mutations close to upstream of PAM recognition sequences.
5. In order to map single base pair mutations, PCR amplify a 468 bp sequence spanning the whole exon 1 of L2HGDH and subject to Sanger sequencing followed by multiple sequence alignment analysis using clustalw⁸.

4. hESC-differentiation and embryoid body (EB) formation assay

1. Proceed with the directed differentiation of control and different CRISPR clones of hESCs (H9) towards neuro-ectoderm fate following established protocols as previously described using dual smad inhibition method^9,10,11.
2. When at 90% confluency, treat the cells with LDN193189 (200 nM) and SB431542 (10 µM) for an initial 24 h in 100% KSR media followed by the addition of XAV939 (2 µM) for additional 2 days.
3. After 3 days, reduce the percentage of KSR media (Knockout DMEM supplemented with 15% (v/v) KSR, 1% (v/v) L-glutamine, 1% (v/v) P/S, 1% (v/v) 10 mM MEM, and 0.1% (v/v) 2-mercaptoethanol (75%, 50%, 25%) by combining with N2 media (DMEM/F12 supplemented with 1x N2 supplement, 1x P/S,) to 100% N2 media over a period of 8 days.
4. At the beginning of Day 12, fix the cells for immunostaining using PAX6 as a neuro-ectoderm marker.
5. For mesoderm and endodermal fate determination studies, employ a small molecule CHIR99021-based approach described in previous publications^12,13.
6. For this, when the cells reach 70% confluency, treat with 3 µM of CHIR99021 in Definitive Endoderm (DE) media for 24 h followed by fixation for immunostaining using Brachuary as mesoderm-specific marker.
7. For the endodermal stage, culture the cells for an additional 24 h in DE media alone without the addition of CHIR99021 before fixing for immunostaining using FOXA2.
8. For EB formation assay, seed the cells on low attachment cell surfaces without using Matrigel to culture cells under suspension conditions for 24 h before taking micrographs.

5. Western blot analysis

1. Wash the cells twice using PBS and lyse using 1x RIPA buffer containing 1% SDS and 1x protease and phosphatase inhibitor cocktail.
2. Clear the lysates by centrifugation at 16,000 x g for 10 min at 4 °C followed by collection of the supernatants.
3. Quantify the total cell protein using the BCA protein assay kit following the manufacturer's instructions. Adjust the samples to 2 µg/µL using 4× loading dye sample buffer.
4. Denature the protein samples at 70 °C for 10 min, load equal amounts of each sample, and resolve using 4%-12% gradient SDS-PAGE gels⁷ followed by transfer to PVDF membrane at a constant voltage of 100 V for 1 h at 4 °C.
5. Block the membranes using 5% non-fat milk and incubate in primary antibody dilutions at 4 °C overnight with rotation.
6. Next, wash the membranes 5x using PBST buffer and incubate in HRP-conjugated appropriate secondary antibodies for 1 h at room temperature.
7. Wash the membranes again with PBST 5x, incubate with chemiluminescent substrate, and develop using X-ray films.

6. Immunostaining

1. Seed the cells on P4 well plates and incubate for at least 24 h before fixation to allow proper attachment of cells to surfaces.
2. Wash the cells 3x with PBS to remove any dead cells as well as media components, followed by fixation using 4% PFA for 15 min at room temperature.
3. Permeabilize the cells by using 0.3% triton X-100 followed by blocking for nonspecific binding by using 2% BSA in PBS for 1 h at room temperature.
4. Incubate the samples with primary antibodies (OCT4, NANOG, SOX2, KI67, PAX6, Brachuary, FOXA2) diluted in 1% BSA overnight at 4 °C.
5. Wash the cells 3x with PBS and incubate with appropriate secondary antibodies (Goat anti-mouse 488, Goat anti-rabbit 488, Goat anti-mouse 546, Goat anti-rabbit 546) diluted in 1% BSA for 1 h at room temperature.
6. Finally, wash the samples with PBS 3x and counterstain them with DAPI and image using a fluorescence microscope.

Results

Cloning of L2HGDH sgRNAs in lentiCRISPRv2 puro
lentiCRISPRv2 puro vector was commercially obtained (see Table of Materials) and digested with BsmB1, which resulted in the release of a 1.8 Kb stuffer fragment. As shown in Figure 2A, a complete digestion of the vector was observed. For each construct, six clones were screened for the presence or absence of insert using reverse sgRNA sequence as a primer and a forward primer (U6-459F) from within the vect...

Discussion

This study has standardized a method that enables highly efficient and cost-effective gene deletions in hESCs through CRISPR-Cas9 technology. This method successfully achieved homozygous deletion of the L2HGDH gene in hESCs within 3-4 weeks, starting from hESC infection to single-cell clonal selection and propagation (Table 1). Although CRISPR-Cas9-mediated gene manipulations can be achieved by transient transfections in most cells, this becomes challenging in stem cells due to poor transfection efficien...

Materials

Name	Company	Catalog Number	Comments
2-MERCAPTOETHANOL	Invitrogen	31350010
38.5 mL, Sterile + Certified Free Open-Top Thinwall Ultra-Clear Tubes	Beckman Coulter	C14292
Accutase	Stem cell technologies	7920
bFGF Recombinant human	Invitrogen	PHG0261
Brachyury Rabbit mAb	Abclonal	A5078
BsmBI-v2	NEB	R0739S
chir99021	Tocris	4423/10
Corning Matrigel Basement Membrane Matrix, LDEV-free	Corning	354234
Cyclopamine	Stem cell technologies	72074
DMEM media	Invitrogen	11995073
DMEM NUTRIENT MIX F12	Invitrogen	11320033
DPBS w/o: Ca and Mg	PAN Biotech	P04-36500
Fetal bovie serum	Invitrogen	10270106
FoxA2/HNF3β	CST	8186
GAPDH (14C10) Rabbit mAb Antibody	CST	2118S
Gentle Cell Dissociation Reagent	Stem cell technologies	7174
HyClone Non Essential Amino Acids (NEAA) 100x Solution	GE healthcare	SH30238.01
Ki-67 (D3B5) Rabbit mAb	CST	9129
KnockOut Serum Replacement	Invitrogen	10828028
L GLUTAMINE, 100x	Invitrogen	2924190090
L2H-BMSBSP-F1	Macrogen		CGTGCGGGTTCGCGTCTGGG
L2HGDH Polyclonal antibody	Proteintech	15707-1-AP
L2HGDH-SgRNA1-F	Macrogen		CACCGCGTGCGG GTTCGCGTCTGGG
L2HGDH-SgRNA1-R	Macrogen		AAACCCCAGACGC GAACCCGCACGC
L2HGDH-SgRNA2-F	Macrogen		CACCGCCCGCGG GCTTTTCGCCGG
L2HGDH-SgRNA2-R	Macrogen		AAACCCGGCGAA AAGCCCGCGGGC
L2H-SeqF1	Macrogen		GCTAAAGAGCGC GGGTCCTCGG
L2H-SeqR1	Macrogen		GTGGACGGGTTG TTCAAAGCCAGAG
L2H-UMSBSP-R1	Macrogen		GTGGACGGGTTG TTCAAAGCCAGAG
LentiCRISPRv2	Addgene	52961
mTesR1 complete media	Stem cell technologies	85850
Nanog Antibody	CST	3580
NEUROBASAL MEDIUM 1x CTS	Invitrogen	A1371201
Neuropan 2 Supplement 100x	PAN Biotech	P07-11050
Neuropan 27 Supplement 50x	PAN Biotech	P07-07200
Oct-4 Antibody	CST	2750
Pax6 (D3A9V) XP Rabbit mAb	CST	60433
PENICILLIN STREPTOMYCIN SOL	Invitrogen	15140122
pMD2.G	Addgene	12259
Polybrene infection reagent	Sigma	TR1003- G
Polyethylenimine, branched	Sigma	408727
psPAX2.0	Addgene	12260
Puromycin	Invitrogen	A1113802
qPCR Lentivirus Titer Kit	Abm	LV900
Rock inhibitor Y-27632 dihydrochloride	Tocris	1254
SB 431542	Tocris	1614/10
Sox2 Antibody	CST	2748
Sucrose	Sigma	57-50-1
TRYPSIN .05% EDTA	Invitrogen	25300062
U6-459F	Macrogen		GAGGGCCTATT TCCCATGATTC
Wizard Genomic DNA Purification Kit	Promega	A1120
XAV 939	Tocris	3748/10