A subscription to JoVE is required to view this content. Sign in or start your free trial.
This manuscript describes the operational procedures and precautions to probe the potential common pathogenic mechanisms linking primary Sjogren's syndrome and lung adenocarcinoma through bioinformatics analysis and experimental verification.
This study aimed to probe the potential common pathogenic mechanisms linking primary Sjogren's syndrome (pSS) and lung adenocarcinoma (LUAD) through bioinformatics analysis and experimental verification. The relevant genes associated with pSS and LUAD were retrieved from the Gene Expression Omnibus (GEO) database and Genecard database. Subsequently, differentially expressed genes (DEGs) associated with pSS and LUAD were screened as pSS-LUAD-DEGs. Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) enrichment analyses were performed to elucidate the significant biological functions of pSS-LUAD-DEGs. Core targets were identified by constructing the protein-protein interaction (PPI) network, further assessing hub gene diagnostic accuracy through Receiver Operating Characteristic (ROC) curve analyses. In this study, NOD/Ltj mice served as pSS animal models and were stimulated with particulate matter 2.5 (PM2.5) to generate an inflammatory reaction. Quantitative real-time polymerase chain reaction (qPCR), enzyme-linked immunosorbent assay (ELISA), and western blotting were employed for relevant molecular biology experiment verification. The results revealed through KEGG and GO enrichment analyses indicate that inflammation plays a critical role in linking pSS and LUAD. IL6, CCNA2, JAK2, IL1B, ASPM, CCNB2, NUSAP1, and CEP55 were determined as key targets of pSS-LUAD. BALB/c mice and NOD/Ltj mice exhibited enhanced expression of inflammatory cytokines IL-6 and IL-1Ξ² in lung tissues following 21 days of stimulation with PM2.5, activating the JAK2/STAT3 signaling pathway and up-regulating the expression of tumor-associated genes CCNA2, CCNB2, and CEP55, with NOD/Ltj mice exhibiting more pronounced changes than BALB/c mice. This protocol demonstrates that carcinogenesis induced by the pulmonary inflammatory microenvironment may be a key reason for the high incidence of LUAD in pSS patients. Additionally, blocking-related mechanisms may help prevent the occurrence of LUAD in pSS patients.
Primary SjΓΆgren's syndrome (pSS) is an autoimmune disease characterized by lymphocytic infiltration of the exocrine glands and leads to the clinical symptoms of dry eyes (xerophthalmia) and dry mouth (xerostomia)1,2. pSS is also usually accompanied by extra-glandular manifestations of involvement, including hyperglobulinemia3, interstitial lung disease4, renal tubular acidosis5, neurological damage6, and thrombocytopenia7, which constitute the main adverse prognostic factors. In recent years, a line of studies has demonstrated that pSS is generally accompanied by an increased prevalence of cancer, including hematological malignancies and solid tumors8,9,10. Lung cancer is one of the most common pSS-related cancers, especially lung adenocarcinoma (LUAD)11.
Collectively, further investigation suggested that pSS with LUAD may have some underlying common pathogenesis. According to our current knowledge, no special studies yet explain the common mechanisms between the two diseases. Recently, bioinformatics analysis offer a potential possibility for us to reveal potentially shared disease mechanisms across species12,13,14. To further reveal the underlying mechanisms, bioinformatics analysis is used for the analysis of common targets and signaling pathways between pSS and LUAD, and animal models are subsequently established for experimental verification. Revealing these mechanisms may help provide an evidence base for clinical prevention of LUAD in pSS patients.
This study used the GEO and Genecard databases to retrieve the relevant genes associated with pSS and LUAD. Afterward, DEGs associated with pSS and LUAD were screened as pSS-LUAD-DEGs. We performed KEGG and GO enrichment analyses to elucidate the significant biological functions of pSS-LUAD-DEGs. PPI network construction was used to identify core targets, and we further assessed hub gene diagnostic accuracy through ROC curve analyses. We used NOD/Ltj mice as pSS animal models stimulated with particulate matter 2.5 (PM2.5) to generate an inflammatory reaction. QPCR, ELISA, and western blotting were performed to verify the study experimentally. Overall, the results here indicate that carcinogenesis induced by the pulmonary inflammatory microenvironment may be a critical reason for the high incidence of LUAD in pSS patients. It also suggests that the occurrence of LUAD in pSS patients may be prevented by blocking-related mechanisms.
The experimental animals were housed in the animal facility of the China-Japan Friendship Hospital, where the housing conditions met the animal feeding environment in line with China's national standard, Laboratory Animal-Requirements of Environment and Housing Facilities (GB14925-2010). All animal care procedures and experiments complied with the ARRIVE guidelines and were based on the 3R principles (reduction, replacement, refinement), adhering to the guidelines of the National Animal Welfare Law of China. BALB/c mice were purchased from SPF (Beijing) Biotechnology Co., Ltd., and NOD/Ltj mice were purchased from Huafukang (Beijing) Biotechnology Co., Ltd.
1. Bioinformatics analysis
2. Experimental verification
NOTE: Refer to the Table of Materials for details on the materials, reagents, and instruments used in this protocol.
Gene name | Sequence (5β² to 3β²) |
Mouse CCNA2 forward | CCCAGAAGTAGCAGAGTTTGTG |
Mouse CCNA2 reverse | TTGTCCCGTGACTGTGTAGAG |
Mouse ASPM forward | CTTATTCAGGCTATGTGGAGGA |
Mouse ASPM reverse | CCAGGCTTGAATCTTGCAG |
Mouse CCNB2 forward | TTGAAATTTGAGTTGGGTCGAC |
Mouse CCNB2 reverse | CTGTTCAACATCAACCTCCC |
Mouse NUSAP1 forward | CTCCCTCAAGTACAGTGACC |
Mouse NUSAP1 reverse | TTTAACAACTTGGTTGCCCTC |
Mouse CEP55 forward | CCGCCAGAATATGCAGCATCAAC |
Mouse CEP55 reverse | AGTGGGAATGGCTGCTCTGTGA |
Table 1: Prime sequences for quantitative real-time PCR.
A total of 3290 DEGs were identified from the 23348 genes in GSE84884 (pSS), including 2659 up-regulated genes and 631 down-regulated genes (Figure 1A). For GSE51092 (pSS), a total of 3290 DEGs were identified from the 11409 genes, including 667 up-regulated genes and 587 down-regulated genes (Figure 1B). The GeneCards database obtained 102 ovarian pSS-related DEGs, and the correlation score of screening criteria was β₯20. The union and deduplication of the...
Although pSS is considered a disease primarily characterized by the invasion of exocrine glands, the damage of extra-glands cannot be ignored24. The lungs represent a target organ for pSS, and lung involvement is a common extra-glandular manifestation of pSS, typically involving lymphocytic infiltration of the bronchial mucosa and pulmonary interstitium25. Research indicates that at least 20% of pSS patients experience interstitial lung disease (ILD)26
The authors have no conflicts of interest to disclose.
This study was supported by National High Level Hospital Clinical Research Funding (2023-NHLHCRF-BQ-01) and the Youth Project of China-Japan Friendship Hospital (No.2020-1-QN-8).
Name | Company | Catalog Number | Comments |
3-Color Prestained Protein Marker | Epizyme | WJ103 | Western Blot |
Antibody Dilution Buffer | Epizyme | PS119 | Western Blot |
BCA Protein Quantification Kit | Epizyme | ZJ101 | Western Blot |
Cytoscape 3.7.1 software | National Institute of General Medical Sciences (NIGMS), National Institutes of Health (NIH) | Version 3.7.1. | Open-source software for biological network analysis and visualization |
ECL Luminous Fluid | Epizyme | SQ203 | Western Blot |
Electrophoresis Buffer | Epizyme | PS105S | Western Blot |
GraphPad Prism 10.0 | GraphPad | Version 10.0 | Data analysis |
HRP-conjugated Goat anti-Rabbit IgG (H+L) (AS014) | abclonal | AS014 | Western Blot |
JAK2 Antibody | Cell Signaling Technology | 3230T | Western Blot |
Mouse IL-1Ξ² ELISA Kit | BeijingΒ 4AΒ Biotech Co., Ltd | CME0015 | ELISA |
Mouse IL-6 ELISA Kit | BeijingΒ 4AΒ Biotech Co., Ltd | CME0006 | ELISA |
Phosphatase Inhibitor Cocktail (100Γ) | Epizyme | GRF102 | Western Blot |
Phospho-JAK2 (Tyr1007/1008) Antibody | Cell Signaling Technology | 3776S | Western Blot |
Phospho-STAT3 (Tyr705) Antibody | Cell Signaling Technology | 9145S | Western Blot |
Protease Inhibitor Cocktail (100Γ) | Epizyme | GRF101 | Western Blot |
Protein Free Rapid Blocking Buffer (5Γ) | Epizyme | PS108 | Western Blot |
PVDF membrane | Millipore | IPVH00010 | Western Blot |
R software | R Foundation for Statistical Computing | Not Applicable | Statistical analysis software and programming language used for data analysis, visualization, and machine learning applications |
Radio Immunoprecipitation Assay | Epizyme | PC101 | Western Blot |
Reverse Transcription System | Promega | A3500 | PCR |
SDS-PAGE | Epizyme | LK303 | Western Blot |
SDS-PAGE Protein Loading Buffer (5Γ) | Epizyme | LT103 | Western Blot |
STAT3 Antibody | Cell Signaling Technology | 9139S | Western Blot |
SYBR Green Realtime PCR Master Mix | TOYOBO | QPK-201 | PCR |
TBST (10Γ) | Epizyme | PS103 | Western Blot |
Western Blot Transfer Buffer (10Γ) | Epizyme | PS109 | Western Blot |
Ξ²-Actin Antibody | abclonal | AC026 | Western Blot |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright Β© 2025 MyJoVE Corporation. All rights reserved