This study was supported by a grant (2013R1A1A3005669) from the National Research Foundation of Korea and a grant (HI13C0016) of the Korean Health Technology R&#38;D Project, Ministry of Health &#38; Welfare.

1. Probe Preparation
<ol>
	<li>PCR amplification of the probe
	<ol>
		<li>For the P. gingivalis&#8211;specific probe, amplify a 343-bp DNA fragment of P. gingivalis 16S rRNA by PCR using the genomic DNA of P. gingivalis and the following primers: 5&#39;- TGC AAC TTG CCT TAC AGA GG-3&#39; and 5&#39;- ACT CGT ATC GCC CGT TAT TC-3&#39;10. Perform amplifications with the following cycle conditions: 35 cycles at 95 &#176;C for 30 sec, 60 &#176;C for 30 sec, and 72 &#176;C for 1 min 20 sec followed by a 5&#160;min extension at 72 &#176;C10,11.</li>
		<li>Amplify the eubacterial probe using a 70-bp DNA fragment (5&#39;-CAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAG 
		TCCCGCAACGAGCGCAACCC-3&#39;) synthesized as an oligonucleotide and the following primers: 5&#39;-CAG GTR CTG CMT GGY-3&#39; and 5&#39;-AGG GTT GCG CTC GTT-3&#39;11. Perform amplifications with the following cycle conditions: 40 cycles at 9 4&#176;C for 30 sec, 60 &#176;C for 30 sec and 72 &#176;C for 1 min 20 s followed by a 5 min extension at 72 &#176;C11,12.</li>
		<li>Precipitate the PCR products (&#8805;500 &#181;l) by adding 3 M sodium acetate (pH 5.2) and 100% ethanol (at a 10:1:2 ratio) and incubating at -20 &#176;C for 2 hr.</li>
		<li>Centrifuge the mixture at 14,000 x g for 15 min, resuspend the pellet in 100 &#181;l of TE buffer, and measure the DNA concentration by optical density at 260 nm.</li>
	</ol>
	</li>
	<li>DIG-labeling using a DIG DNA labeling and detection kit
	<ol>
		<li>Mix 3 &#181;g of the probe with water to a final volume of 15 &#181;l.</li>
		<li>Denature the DNA at 95 &#176;C for 10 min and quickly chill on ice.</li>
		<li>Add 2 &#181;l of 10x hexanucleotide mix, 2 &#181;l of dNTP-labeling mix, and 1 &#181;l of Klenow enzyme to 15 &#181;l of the denatured DNA.</li>
		<li>Mix and incubate at 37 &#176;C for 24 hr to 48 hr and stop reaction by heating at 65 &#176;C.</li>
	</ol>
	</li>
	<li>Check the sensitivity of the DIG-labeled probe using a DIG DNA labeling and detection kit
	<ol>
		<li>Manually load 1 &#181;l of serial dilutions of the positive control probe provided in the kit and 1 ng of the DIG-labeled probe on the nylon membrane and dry for 5 min at RT.</li>
		<li>Briefly soak the membrane in 2x SSC buffer (0.3 M NaCl, 30 mM sodium citrate, pH 7.0) and incubate the membrane at 80 &#176;C for 1 hr to immobilize the DNA.</li>
		<li>Briefly soak the membrane in maleic acid buffer (MAB, 0.1 M maleic acid, 0.15 M NaCl, pH 7.5) and incubate with anti-DIG alkaline phosphatase (AP)-conjugated antibody diluted (1:5,000) in 6 ml of blocking solution provided in the kit at RT for 30 min.</li>
		<li>Wash the membrane with MABT (MAB containing 1% Tween 20) and apply 40 &#181;l of the NBT/BCIP solution mixed with 2 ml detection buffer (0.1 M Tris-HCl, 0.1 M NaCl, 0.05 M MgCl2, pH 9.5) onto the membrane for 1 min. If the sensitivity of the labeled probe is not satisfying, repeat steps from 1.1.3 to 1.3.4.</li>
		<li>Measure the DNA concentration of the labeled probe (OD260) and adjust the concentration to 100 ng &#181;l-1.</li>
	</ol>
	</li>
	<li>Check the specificity of the DIG-labeled probe
	<ol>
		<li>Denature genomic DNA samples (25 ng 3 &#181;l-1 per each sample) from various bacterial species, including the bacterium targeted by the specific probe, at 95 &#176;C for 10 min and quickly chill on ice.</li>
		<li>Manually load the denatured DNA on the nylon membrane and dry for 20 min at RT.</li>
		<li>Briefly soak the membrane in 2x SSC buffer and incubate the membrane at 80 &#176;C for 2 hr to immobilize the DNA.</li>
		<li>Block the membrane with a blocking solution at RT for 1 hr.</li>
		<li>Dilute the probe at 1 ng &#181;l-1 in hybridization buffer, denature the diluted probes, and apply onto the membrane.</li>
		<li>Incubate the membrane at 45 &#176;C for 1 hr.</li>
		<li>Wash the membrane three times with 2x SSC buffer.</li>
		<li>Briefly soak the membrane in MAB.</li>
		<li>Incubate with anti-DIG AP-conjugated antibody diluted (1:2,000) in 6 ml of blocking solution at RT for 1 hr.</li>
		<li>Wash the membrane with MABT and apply 40 &#181;l of the NBT/BCIP solution mixed with 2 ml detection buffer.</li>
		<li>When the probe does not achieve the expected specificity, increase the hybridization temperature until the specificity is observed.</li>
	</ol>
	</li>
</ol>
2.&#160;In Situ Hybridization
Note: To avoid drying of the specimens and reagents, perform all incubations in a humidified chamber lined with wet paper towels.
<ol>
	<li>De-paraffinization and rehydration of tissue sections
	<ol>
		<li>Prepare 4 &#181;m thick tissue sections from paraffin-embedded blocks. Formalin, paraformaldehyde, and zinc-based fixative are compatible with this protocol.</li>
		<li>Prepare all reagents using DEPC-treated water.</li>
		<li>Heat slides in a dry oven at 60 &#176;C for 30 min and incubate slides at RT for 30 min.</li>
		<li>Immerse slides in 100% xylene for 5 min three times; use fresh xylene each time. 
		Note: Do this de-waxing procedure in a chemical fume hood.</li>
		<li>Immerse slides in 100% ethanol for 5 min twice, using fresh ethanol each time, and rehydrate specimens in serial 90%, 80% and 70% ethanol solutions for 5 min each.</li>
		<li>Immerse slides in DEPC-treated water for 1 min and wash slides in DEPC-treated PBS (pH 7.4) for 6 min.</li>
	</ol>
	</li>
	<li>Pretreatments of tissue sections
	<ol>
		<li>Immerse slides in 0.1 N hydrochloric acid for 20 min and wash slides in DEPC-treated water for 30 sec.</li>
		<li>Draw a hydrophobic barrier surrounding specimens using a wax pen. 
		Note: The size of the hydrophobic barrier depends on the size of specimens. Therefore, the volumes of reagents used in the following steps vary depending on the size of specimens but have to fill the hydrophobic barrier (50 &#181;l for small specimens and 400 &#181;l for large specimens).</li>
		<li>Treat specimens with 50 to 400 &#181;l of proteinase K (1 to 10 &#181;g ml-1 in DEPC-treated PBS) in a dry oven at 37 &#176;C for 30 min and wash slides in DEPC-treated 1x PBS for 1 min.</li>
		<li>Soak slides in 4% paraformaldehyde in DEPC-treated PBS for 10 min, then wash slides in DEPC-treated PBS for 1 min.</li>
		<li>Soak slides in 0.1 M triethanolamine-HCl (pH 8.0) containing 0.5% acetic anhydride for 20 min and wash slides in DEPC-treated water for 30 sec.</li>
	</ol>
	</li>
	<li>Hybridization with probe and washing
	<ol>
		<li>Immerse slides in 2x SSC buffer for 20 min.</li>
		<li>Dilute the probe at 1 ng &#181;l-1 in hybridization buffer (4x SSC, 50% [vol/vol] formamide, 1x Denhardt&#8217;s solution, 10% [wt/vol] dextran sulfate, 0.1% [wt/vol] sodium dodecyl sulfate, 0.4 mg ml-1 salmon sperm DNA). For negative controls, mix the labeled probe with a 10-fold excess amount of non-labeled probe.</li>
		<li>Denature the diluted probes and apply 50 to 400 &#181;l onto tissue sections. Place a cover slip on the slide and seal with nail polish.</li>
		<li>Heat slides in PCR machine at 90 &#176;C for 10 min and incubate slides in a humidified chamber O/N&#160;at 45 &#176;C or optimal temperature determined at step 1.4.11.</li>
		<li>Cool the slides at 4 &#176;C for 30 min, remove cover slips, and immerse slides in a serial SSC buffer as followings: 4x SSC for 10 min, pre-warmed (45 &#176;C) 2x SSC for 20 min, 2x SSC for 10 min, and 0.2x SSC for 10 min.</li>
	</ol>
	</li>
	<li>Detection with anti-DIG AP-conjugated antibody
	<ol>
		<li>Wash slides in MABT for 5 min.</li>
		<li>Block with 50 to 400 &#181;l of blocking solution with 1% Tween 20 for 20 min.</li>
		<li>Add 50 to 400 &#181;l of anti-DIG-AP antibody diluted in blocking solution (1:1,000) anld incubate at 37 &#176;C for 90 min.</li>
		<li>Wash slides in MABT for 10 min.</li>
		<li>Immerse slides in detection buffer containing 1% Tween 20 for 5 min.</li>
		<li>Treat with 50 to 400 &#181; of 1 mM levamisole (in detection buffer containing 1% Tween 20) for 5 min to inactivate endogenous alkaline phosphatase.</li>
		<li>Distribute 50 to 400 &#181;l of the premixed NBT/BCIP solution (diluted in detection buffer at 1:100) onto each specimen and incubate slides in a humidified chamber at RT for 2 to 3 hr until the developed signal is satisfactory.</li>
		<li>Rinse slides with de-ionized water to stop visualization and apply 50 to 400 &#181;l of 0.05% [wt/vol] methyl green as a counter stain at 37 &#176;C for 10 min.</li>
		<li>Rinse slides with de-ionized water, dehydrate in 100% ethanol, and immerse in xylene.</li>
		<li>Apply 80 &#181;l of mounting solution onto each slide and cover with cover slips.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Takarada, H., Cattoni, M., Sugimoto, A., Rose, G. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructural+studies+of+human+gingiva.+II.+The+lower+part+of+the+pocket+epithelium+in+chronic+periodontitis.">Ultrastructural studies of human gingiva. II. The lower part of the pocket epithelium in chronic periodontitis.</a> J. Periodontol. 45 (3), 155-169 (1974).</li><li>Allenspach-Petrzilka, G. E., Guggenheim, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+invasion+of+the+periodontium;+an+important+factor+in+the+pathogenesis+of+periodontitis.">Bacterial invasion of the periodontium; an important factor in the pathogenesis of periodontitis.</a> J. Clin. Periodontol. 10 (6), 609-617 (1983).</li><li>Saglie, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+presence+of+bacteria+in+the+oral+epithelium+in+periodontal+disease.+II.+Immunohistochemical+identification+of+bacteria.">The presence of bacteria in the oral epithelium in periodontal disease. II. Immunohistochemical identification of bacteria.</a> J. Periodontol. 57 (8), 492-500 (1986).</li><li>Christersson, L. A., Albini, B., Zambon, J. J., Wikesj&#246;, U. M., Genco, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+localization+of+Actinobacillus+actinomycetemcomitans.+in+human+periodontitis.+I.+Light,+immunofluorescence+and+electron+microscopic+studies.">Tissue localization of Actinobacillus actinomycetemcomitans. in human periodontitis. I. Light, immunofluorescence and electron microscopic studies.</a> J. Periodontol. 58 (8), 529-539 (1987).</li><li>Saglie, F. R., Pertuiset, J., Rezende, M. T., Nestor, M., Marfany, A., Cheng, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ.+correlative+immuno-identification+of+mononuclear+infiltrates+and+invasive+bacteria+in+diseased+gingiva.">In situ. correlative immuno-identification of mononuclear infiltrates and invasive bacteria in diseased gingiva.</a> J. Periodontol. 59 (10), 688-696 (1988).</li><li>Rautemaa, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+localization+of+Porphyromonas+gingivalis.+thiol+proteinase+in+periodontal+tissues+of+chronic+periodontitis+patients.">Intracellular localization of Porphyromonas gingivalis. thiol proteinase in periodontal tissues of chronic periodontitis patients.</a> Oral Dis. 10 (5), 298-305 (2004).</li><li>Marttila, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+localization+of+Treponema+denticola.+chymotrypsin-like+proteinase+in+chronic+periodontitis.">Intracellular localization of Treponema denticola. chymotrypsin-like proteinase in chronic periodontitis.</a> J. Oral Microbiol. 6, (2014).</li><li>Colombo, A. V., da Silva, C. M., Haffajee, A., Colombo, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+intracellular+oral+species+within+human+crevicular+epithelial+cells+from+subjects+with+chronic+periodontitis+by+fluorescence+in+situ.+hybridization.">Identification of intracellular oral species within human crevicular epithelial cells from subjects with chronic periodontitis by fluorescence in situ. hybridization.</a> J. Periodontal Res. 42 (3), 236-243 (2007).</li><li>Abrams, K., Caton, J., Polson, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histologic+comparisons+of+interproximal+gingival+tissues+related+to+the+presence+or+absence+of+bleeding.">Histologic comparisons of interproximal gingival tissues related to the presence or absence of bleeding.</a> J. Periodontol. 55 (11), 629-632 (1984).</li><li>Kim, Y. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presence+of+Porphyromonas+gingivalis.+and+plasma+cell+dominance+in+gingival+tissues+with+periodontitis.">Presence of Porphyromonas gingivalis. and plasma cell dominance in gingival tissues with periodontitis.</a> Oral Dis. 16 (4), 375-381 (2010).</li><li>Choi, Y. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Porphyromonas+gingivalis.+and+dextran+sodium+sulfate+induce+periodontitis+through+the+disruption+of+physical+barriers.">Porphyromonas gingivalis. and dextran sodium sulfate induce periodontitis through the disruption of physical barriers.</a> Eur. J. Inflammation. 10, 419-431 (2013).</li><li>Choi, Y. S., Kim, Y. C., Ji, S., Choi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Increased+bacterial+invasion+and+differential+expression+of+tight+junction+proteins,+growth+factors,+and+growth+factor+receptors+in+periodontal+lesions.">Increased bacterial invasion and differential expression of tight junction proteins, growth factors, and growth factor receptors in periodontal lesions.</a> J. Periodontol. 85 (8), e313-e322 (2014).</li><li>Baker, G. C., Smith, J. J., Cowan, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review+and+re-analysis+of+domain-specific+16S+primers.">Review and re-analysis of domain-specific 16S primers.</a> J. Microbiol. Methods. 55 (3), 541-555 (2003).</li><li>Hajishengallis, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Low-abundance+biofilm+species+orchestrates+inflammatory+periodontal+disease+through+the+commensal+microbiota+and+the+complement.">A Low-abundance biofilm species orchestrates inflammatory periodontal disease through the commensal microbiota and the complement.</a> Cell Host Microbe. 10 (5), 497-506 (2011).</li><li>Axon, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gastric+cancer+and+Helicobacter+pylori.">Gastric cancer and Helicobacter pylori.</a> Aliment. Pharmacol. Ther. 16 (suppl. 4), 83-88 (2002).</li><li>Fenhalls, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ.+detection+of+Mycobacterium+tuberculosis+transcripts+in+human+lung+granulomas+reveals+differential+gene+expression+in+necrotic+lesions.">In situ. detection of Mycobacterium tuberculosis transcripts in human lung granulomas reveals differential gene expression in necrotic lesions.</a> Infect. Immun. 70 (11), 6330-6338 (2002).</li></ol>

The authors have nothing to disclose.

Here a protocol to localize bacteria within paraffin-embedded tissues using a DIG-labeled DNA probe has been described. The probe targets the DNA or RNA molecules of bacterial 16S rRNA gene, and the 16S rRNA-targeting probes can be designed as either species-specific or universal. The specific hybridization of the P. gingivalis-specific probe to P. gingivalis but not to other oral bacteria has been previously shown10. In contrast, the eubacterial probe hybridized to all bacterial genomic DNA ...

Bacteria play a role in the etiology of various oral diseases such as periodontitis, pulpitis, pericoronitis, cellulitis, and osteomyelitis. In order to understand the role of bacteria in the pathogenesis of disease and to monitor the effect of treatments, localization of bacteria within the tissue is important. The presence of bacteria within gingival tissue from patients with periodontitis has been shown using various methods, including electron microscopy1,2, immunohistochemistry and immunofluorescence using bacteria-specific antibodies3-7, and fluorescent in situ hybridization (FISH)8 using a fluorescence-labeled oligonucleotide probe targeting 16S rRNA. Nevertheless, these methods are not widely used due to technical limitation or difficulties. Compared with antibodies, probes targeting 16S rRNA are easy to produce and achieve species-specificity. FISH has proven to be an excellent tool for the visualization of bacteria in their natural environments such as plaque biofilm. However, application of FISH to tissue samples is limited due to autofluorescence of various tissue components. For example, the strong autofluorescence of red blood cells often hampers the application of fluorescence technology to inflamed tissues when they involve bleeding9.
In order to localize bacteria within the inflamed gingival tissues, therefore, an in situ hybridization method using a digoxigenin (DIG)-labeled DNA probe has been developed and successfully applied10,11. Here a detailed protocol for the localization of bacteria within paraffin-embedded tissues using P. gingivalis-specific and universal eubacterial probes has been described. It is particularly focused on standardization of the method so that similar results can be reproduced in other laboratories. This protocol allows localization of bacteria within their histological context and the results are highly reproducible. The described protocol can be used to localize bacteria either in a species-specific or universal manner in various tissues. The universal probe is especially useful to detect bacteria in polymicrobial diseases and to study a potential role of bacteria in diseases where the role of specific bacteria is not known.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Acetic anhydride</td>
			<td>Sigma</td>
			<td>6404</td>
			<td></td>
		</tr>
		<tr>
			<td>50% Dextran sulfate solution</td>
			<td>Millipore</td>
			<td>S4030</td>
			<td></td>
		</tr>
		<tr>
			<td>50X Denhardt&#8217;s solution</td>
			<td>Sigma</td>
			<td>D2532</td>
			<td></td>
		</tr>
		<tr>
			<td>DEPC</td>
			<td>Sigma</td>
			<td>P159220</td>
			<td></td>
		</tr>
		<tr>
			<td>DIG DNA labeling and detection kit</td>
			<td>Roche</td>
			<td>11 093 657 910</td>
			<td></td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>Sigma</td>
			<td>F9037</td>
			<td></td>
		</tr>
		<tr>
			<td>ImmEdge&#8482; Pen</td>
			<td>Dako</td>
			<td>H-400</td>
			<td></td>
		</tr>
		<tr>
			<td>Levamisole</td>
			<td>Vector</td>
			<td>SP-5000</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium chloride</td>
			<td>Sigma</td>
			<td>246964</td>
			<td></td>
		</tr>
		<tr>
			<td>Maleic acid</td>
			<td>Sigma</td>
			<td>M0375</td>
			<td></td>
		</tr>
		<tr>
			<td>Methyl green</td>
			<td>Sigma</td>
			<td>M6776</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraformaldehyde</td>
			<td>Sigma</td>
			<td>P1648</td>
			<td></td>
		</tr>
		<tr>
			<td>Permount</td>
			<td>Fisher</td>
			<td>SP15-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Salmon sperm DNA solution</td>
			<td>Invitrogen</td>
			<td>#15632-011</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Sigma</td>
			<td>S9625</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium citrate</td>
			<td>Duksan</td>
			<td>D1420</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium dodecyl sulfate</td>
			<td>Amresco</td>
			<td>227</td>
			<td></td>
		</tr>
		<tr>
			<td>Triethanolamine-HCl</td>
			<td>Sigma</td>
			<td>90279</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl</td>
			<td>Research organics</td>
			<td>3098T</td>
			<td></td>
		</tr>
	</tbody>
</table>

in situ detection of bacteria within paraffin-embedded tissues using a digoxin-labeled dna probe targeting 16s rrna

The presence of bacteria within the pocket epithelium and underlying connective tissue in gingival biopsies from patients with periodontitis has been reported using various methods, including electron microscopy, immunohistochemistry or immunofluorescence using bacteria-specific antibodies, and fluorescent in situ hybridization (FISH) using a fluorescence-labeled oligonucleotide probe. Nevertheless, these methods are not widely used due to technical limitation or difficulties. Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled DNA probes has been introduced. The paraffin-embedded tissues are the most common form of biopsy tissues available from pathology banks. Bacteria can be detected either in a species-specific or universal manner. Bacterial signals are detected as either discrete forms (coccus, rod, fusiform, and hairy form) of bacteria or dispersed forms. The technique allows other histological information to be obtained: the epithelia, connective tissue, inflammatory infiltrates, and blood vessels are well distinguished. This method can be used to study the role of bacteria in various diseases, such as periodontitis, cancers, and inflammatory immune diseases.

Figure 1 shows dot blotting of DIG-labeled probes compared with the positive control probe provided in the kit to determine their sensitivity. The 343 bp P. gingivalis-specific probe is 25 times more sensitive than the 70 bp eubacterial probe. Figure 2 shows in situ hybridization of gingival tissues obtained from patients with chronic periodontitis for detection of P. gingivalis and eubacteria. The bacterial signals, shown in violet, were detected within the ep...

Watch this Scientific Journal Video about In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA at JoVE.com

In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled 16S rRNA-targeting DNA probes has been described. This protocol can be applied to study the role of bacteria in various diseases such as periodontitis, cancers, and inflammatory immune diseases.

In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

The presence of bacteria within the pocket epithelium and underlying connective tissue in gingival biopsies from patients with periodontitis has been ...

in-situ-detection-bacteria-within-paraffin-embedded-tissues-using

Research

JoVE Journal

Immunology and Infection

10.9K Aufrufe.  School of Dentistry and Dental Research Institute, Seoul National University. Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled 16S rRNA-targeting DNA probes has been described. This protocol can be applied to study the role of bacteria in various diseases such as periodontitis, cancers, and inflammatory immune diseases.

Serie: In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in situ hybridization (FISH) for rapid culture-independent detection of Salmonella spp. Cell-charged tapes can also be placed face-down on selective agar for solid-phase enrichment prior to detection. Alternatively, low-volume liquid enrichments (liquid surface miniculture) can be performed on the surface of the tape in non-selective broth, followed by FISH and analysis via flow cytometry. To begin, sterile adhesive tape is brought into contact with fresh produce, gentle pressure is applied, and the tape is removed, physically extracting microbes present on these surfaces. Tapes are mounted sticky-side up onto glass microscope slides and the sampled cells are fixed with 10% formalin (30 min) and dehydrated using a graded ethanol series (50, 80, and 95%; 3 min each concentration). Next, cell-charged tapes are spotted with buffer containing a Salmonella-targeted DNA probe cocktail and hybridized for 15 - 30 min at 55&deg;C, followed by a brief rinse in a washing buffer to remove unbound probe. Adherent, FISH-labeled cells are then counterstained with the DNA dye 4',6-diamidino-2-phenylindole (DAPI) and results are viewed using fluorescence microscopy. For solid-phase enrichment, cell-charged tapes are placed face-down on a suitable selective agar surface and incubated to allow in situ growth of Salmonella microcolonies, followed by FISH and microscopy as described above. For liquid surface miniculture, cell-charged tapes are placed sticky side up and a silicone perfusion chamber is applied so that the tape and microscope slide form the bottom of a water-tight chamber into which a small volume (&le; 500 &mu;L) of Trypticase Soy Broth (TSB) is introduced. The inlet ports are sealed and the chambers are incubated at 35 - 37&deg;C, allowing growth-based amplification of tape-extracted microbes. Following incubation, inlet ports are unsealed, cells are detached and mixed with vigorous back and forth pipetting, harvested via centrifugation and fixed in 10% neutral buffered formalin. Finally, samples are hybridized and examined via flow cytometry to reveal the presence of Salmonella spp. As described here, our "tape-FISH" approach can provide simple and rapid sampling and detection of Salmonella on tomato surfaces. We have also used this approach for sampling other types of fresh produce, including spinach and jalape&ntilde;o peppers.

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple adhesive-tape-based approach for sampling of tomato and other fresh produce surfaces, followed by rapid whole cell detection of Salmonella using fluorescence in situ hybridization (FISH).

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in ...

ampliPHOX Colorimetric Detection on a DNA Microarray for Influenza

DNA microarrays have emerged as a powerful tool for pathogen detection.1-5 For instance, many examples of the ability to type and subtype influenza virus have been demonstrated.6-11 The identification and subtyping of influenza on DNA microarrays has applications in both public health and the clinic for early detection, rapid intervention, and minimizing the impact of an influenza pandemic. Traditional fluorescence is currently the most commonly used microarray detection method. However, as microarray technology progresses towards clinical use,1 replacing expensive instrumentation with low cost detection technology exhibiting similar performance characteristics to fluorescence will make microarray assays more attractive and cost-effective.
The ampliPHOX colorimetric detection technology is intended for research applications, and has a limit of detection within one order of magnitude of traditional fluorescence11, with a main advantage being an approximate ten-fold lower instrument cost compared to the confocal microarray scanners required for fluorescence microarray detection. Another advantage is the compact size of the instrument which allows for portability and flexibility, unlike traditional fluorescence instruments. Because the polymerization technology is not as inherently linear as fluorescence detection, however, it is best suited for lower density microarray applications in which a yes/no answer for the presence of a certain sequence is desired, such as for pathogen detection arrays. Currently the maximum spot density compatible with ampliPHOX detection is &tilde;1800 spots/array. Because of the spot density limitations, higher density microarrays are not suitable for ampliPHOX detection.
Here, we present ampliPHOX colorimetric detection technology as a method of signal amplification on a low density microarray developed for the detection and characterization of influenza viruses (FluChip). Although this protocol uses the FluChip (a DNA microarray) as one specific application of ampliPHOX detection, any microarray incorporating biotinylated target can be labeled and detected in a similar manner. The microarray design and biotinylation of the target to be captured are the responsibility of the user. Once the biotinylated target has been captured on the array, ampliPHOX detection can be performed by first tagging the array with a streptavidin-label conjugate (ampliTAG). Upon light exposure using the ampliPHOX Reader instrument, polymerization of a monomer solution (ampliPHY) occurs only in regions containing ampliTAG-labeled targets. The polymer formed can be subsequently stained with a non-toxic solution to improve visual contrast, followed by imaging and analysis using a simple software package (ampliVIEW). The entire FluChip assay from un-extracted sample to result can be performed in about 6 hours, and the ampliPHOX detection steps described above can be completed in about 30 min.

ampliPHOX colorimetric detection technology is presented as an inexpensive alternative to fluorescence detection for microarrays. Based on photopolymerization, ampliPHOX produces solid polymer spots visible to the naked eye in just a few minutes. Results are then imaged and automatically interpreted with a simple yet powerful software package.

DNA microarrays have emerged as a powerful tool for pathogen detection.1-5  For instance, many examples of the ability to type and subtype influenza virus ...

Multiplex Detection of Bacteria in Complex Clinical and Environmental Samples using Oligonucleotide-coupled Fluorescent Microspheres

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated to a microbiota dominated by a number of bacterial species, including Gardnerella vaginalis, Atopobium vaginae, and others1-3. This condition is associated with a range of negative health outcomes, including HIV acquisition4, and it can be difficult to manage clinically5. Furthermore, diagnosis of BV has relied on the use of Gram stains of vaginal swab smears that are scored on various numerical criteria6,7. While this diagnostic is simple, inexpensive, and well suited to resource-limited settings, it can suffer from problems related to subjective interpretations and it does not give a detailed profile of the composition of the vaginal microbiota8. Recent deep sequencing efforts have revealed a rich, diverse vaginal microbiota with clear differences between samples taken from individuals that are diagnosed with BV compared to those individuals that are considered normal9,10, which has resulted in the identification of a number of potential targets for molecular diagnosis of BV11,12. These studies have provided a wealth of useful information, but deep sequencing is not yet practical as a diagnostic method in a clinical setting. We have recently described a method for rapidly profiling the vaginal microbiota in a multiplex format using oligonucleotide-coupled fluorescent beads with detection on a Luminex platform13. This method, like current Gram stain-based methods, is rapid and simple but adds the additional advantage of exploiting molecular knowledge arising from sequencing studies in probe design. This method therefore provides a way to profile the major microorganisms that are present in a vaginal swab that can be used to diagnose BV with high specificity and sensitivity compared to Gram stain while providing additional information on species presence and abundance in a semi-quantitative and rapid manner. This multiplex method is expandable well beyond the range of current quantitative PCR assays for particular organisms, which is currently limited to 5 or 6 different assays in a single sample14. Importantly, the method is not limited to the detection of bacteria in vaginal swabs and can be easily adapted to rapidly profile nearly any microbial community of interest. For example, we have recently begun to apply this methodology to the development of diagnostic tools for use in wastewater treatment plants.

We describe a multiplex method for the detection of microorganisms within a sample using oligonucleotide-coupled fluorescent beads. Amplicon from all organisms within a sample is hybridized to a panel of probe-coupled beads. A Luminex or Bio-Plex instrument is used to query each bead for bead type and hybridization signal.

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated ...

Detection of Bacteria Using Fluorogenic DNAzymes

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses each and every year. Prevention of such outbreaks and minimization of the impact of an ongoing epidemic place an ever-increasing demand for analytical methods that can accurately identify culprit pathogens at the earliest stage. Although there is a large array of effective methods for pathogen detection, none of them can satisfy all the following five premier requirements embodied for an ideal detection method: high specificity (detecting only the bacterium of interest), high sensitivity (capable of detecting as low as a single live bacterial cell), short time-to-results (minutes to hours), great operational simplicity (no need for lengthy sampling procedures and the use of specialized equipment), and cost effectiveness. For example, classical microbiological methods are highly specific but require a long time (days to weeks) to acquire a definitive result.1 PCR- and antibody-based techniques offer shorter waiting times (hours to days), but they require the use of expensive reagents and/or sophisticated equipment.2-4 Consequently, there is still a great demand for scientific research towards developing innovative bacterial detection methods that offer improved characteristics in one or more of the aforementioned requirements. Our laboratory is interested in examining the potential of DNAzymes as a novel class of molecular probes for biosensing applications including bacterial detection.5
DNAzymes (also known as deoxyribozymes or DNA enzymes) are man-made single-stranded DNA molecules with the capability of catalyzing chemical reactions.6-8 These molecules can be isolated from a vast random-sequence DNA pool (which contains as many as 1016 individual sequences) by a process known as "in vitro selection" or "SELEX" (systematic evolution of ligands by exponential enrichment).9-16 These special DNA molecules have been widely examined in recent years as molecular tools for biosensing applications.6-8
Our laboratory has established in vitro selection procedures for isolating RNA-cleaving fluorescent DNAzymes (RFDs; Fig. 1) and investigated the use of RFDs as analytical tools.17-29 RFDs catalyze the cleavage of a DNA-RNA chimeric substrate at a single ribonucleotide junction (R) that is flanked by a fluorophore (F) and a quencher (Q). The close proximity of F and Q renders the uncleaved substrate minimal fluorescence. However, the cleavage event leads to the separation of F and Q, which is accompanied by significant increase of fluorescence intensity.
More recently, we developed a method of isolating RFDs for bacterial detection.5 These special RFDs were isolated to "light up" in the presence of the crude extracellular mixture (CEM) left behind by a specific type of bacteria in their environment or in the media they are cultured (Fig. 1). The use of crude mixture circumvents the tedious process of purifying and identifying a suitable target from the microbe of interest for biosensor development (which could take months or years to complete). The use of extracellular targets means the assaying procedure is simple because there is no need for steps to obtain intracellular targets.
Using the above approach, we derived an RFD that cleaves its substrate (FS1; Fig. 2A) only in the presence of the CEM produced by E. coli (CEM-EC).5 This E. coli-sensing RFD, named RFD-EC1 (Fig. 2A), was found to be strictly responsive to CEM-EC but nonresponsive to CEMs from a host of other bacteria (Fig. 3).
Here we present the key experimental procedures for setting up E. coli detection assays using RFD-EC1 and representative results.

We have recently reported a novel approach for generating fluorogenic DNAzyme probes that can be applied to set up a simple, "mix-and-read" fluorescent assay for bacterial detection. These special DNA probes catalyze the cleavage of a chromophore-modified DNA-RNA chimeric substrate in the presence of crude extracellular mixture (CEM) produced by a specific bacterium, thereby translating bacterial detection into fluorescence signal generation. In this report we will describe key experimental procedures where a specific DNAzyme probe denoted "RFD-EC1" is employed for the detection of the model bacterium, Escherichia coli (E. coli).

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses ...

Fluorescence in situ Hybridizations (FISH) for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells and can be further modified to visualize other components in the cell such as infection with viruses and bacteria. Spatial localization and visualization of viruses and bacteria during the infection process is an essential step that complements expression profiling experiments such as microarrays and RNAseq in response to different stimuli. Understanding the spatiotemporal infections with these agents complements biological experiments aimed at understanding their interaction with cellular components. Several techniques for visualizing viruses and bacteria such as reporter gene systems or immunohistochemical methods are time-consuming, and some are limited to work with model organisms&#160;and involve complex methodologies. FISH that targets RNA or DNA species in the cell is a relatively easy and fast method for studying spatiotemporal localization of genes and for diagnostic purposes. This method can be robust and relatively easy to implement when the protocols employ short hybridizing, commercially-purchased probes, which are not expensive. This is particularly robust when sample preparation, fixation, hybridization, and microscopic visualization do not involve complex steps. Here we describe a protocol for localization of bacteria and viruses in insect and plant tissues. The method is based on simple preparation, fixation, and hybridization of insect whole mounts and dissected organs or hand-made plant sections, with 20 base pairs short DNA probes conjugated to fluorescent dyes on their 5&#39; or 3&#39; ends. This protocol has been successfully applied to a number of insect and plant tissues, and can be used to analyze expression of mRNAs or other RNA or DNA species in the cell.

Fluorescence in situ Hybridizations FISH for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

We describe here a simple fluorescence in situ hybridization (FISH) method for the localization of viruses and bacteria in insect and plant tissues. This protocol can be extended for the visualization of mRNA in whole mount and microscopic sections.

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells ...

Rapid Identification of Gram Negative Bacteria from Blood Culture Broth Using MALDI-TOF Mass Spectrometry

An important role of the clinical microbiology laboratory is to provide rapid identification of bacteria causing bloodstream infection. Traditional identification requires the sub-culture of signaled blood culture broth with identification available only after colonies on solid agar have matured. MALDI-TOF MS is a reliable, rapid method for identification of the majority of clinically relevant bacteria when applied to colonies on solid media. The application of MALDI-TOF MS directly to blood culture broth is an attractive approach as it has potential to accelerate species identification of bacteria and improve clinical management. However, an important problem to overcome is the pre-analysis removal of interfering resins, proteins and hemoglobin&#160;contained in blood culture specimens which, if not removed, interfere with the MS spectra and can result in insufficient or low discrimination identification scores. In addition it is necessary to concentrate bacteria to develop spectra of sufficient quality. The presented method describes the concentration, purification, and extraction of Gram negative bacteria allowing for the early identification of bacteria from a signaled blood culture broth.

The application of matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) mass spectrometry (MS) directly to blood culture broth expedites the identification of bacteria. The presented method is a rapid and reliable method for identification of Gram negative bacteria directly from blood culture broth.

An important role of the clinical microbiology laboratory is to provide rapid identification of bacteria causing bloodstream infection. Traditional ...

In Situ Detection of Autoreactive CD4 T Cells in Brain and Heart Using Major Histocompatibility Complex Class II Dextramers

This report demonstrates the use of major histocompatibility complex (MHC) class II dextramers for detection of autoreactive CD4 T cells in situ in myelin proteolipid protein (PLP) 139-151-induced experimental autoimmune encephalomyelitis (EAE) in SJL mice and cardiac myosin heavy chain-&#945; (Myhc) 334-352-induced experimental autoimmune myocarditis (EAM) in A/J mice. Two sets of cocktails of dextramer reagents were used, where dextramers+ cells were analyzed by laser scanning confocal microscope (LSCM): EAE, IAs/PLP 139-151 dextramers (specific)/anti-CD4 and IAs/Theiler&#8217;s murine encephalomyelitis virus (TMEV) 70-86 dextramers (control)/anti-CD4; and EAM, IAk/Myhc 334-352 dextramers/anti-CD4 and IAk/bovine ribonuclease (RNase) 43-56 dextramers (control)/anti-CD4. LSCM analysis of brain sections obtained from EAE mice showed the presence of cells positive for CD4 and PLP 139-151 dextramers, but not TMEV 70-86 dextramers suggesting that the staining obtained with PLP 139-151 dextramers was specific. Likewise, heart sections prepared from EAM mice also revealed the presence of Myhc 334-352, but not RNase 43-56-dextramer+ cells as expected. Further, a comprehensive method has also been devised to quantitatively analyze the frequencies of antigen-specific CD4 T cells in the &#8216;Z&#8217; serial images.

In Situ Detection of Autoreactive CD4 T Cells in Brain and Heart Using Major Histocompatibility Complex Class II Dextramers

The protocol to detect self-reactive CD4 T cells in brain and heart by direct staining with major histocompatibility complex class II dextramers has been described in this report. For comprehensive analysis, a reliable method to enumerate the frequencies of antigen-specific CD4+ T cells in situ is also devised.

This report demonstrates the use of major histocompatibility complex (MHC) class II dextramers for detection of autoreactive CD4 T cells in situ in myelin ...

A Novel Microdissection Approach to Recovering Mycobacterium tuberculosis Specific Transcripts from Formalin Fixed Paraffin Embedded Lung Granulomas

Microdissection has been used for the examination of tissues at DNA, RNA, and protein levels for over a decade. Laser capture microscopy (LCM) is the most common microdissection technique used today. In this technique, a laser is used to focally melt a thermoplastic membrane that overlies a dehydrated tissue section1. The tissue section composite is then lifted and separated from the membrane. Although this technique can be used successfully for tissue examination, it is time consuming and expensive. Furthermore, the successful completion of procedures using this technique requires the use of a laser, thus limiting its use. A new more affordable and practical microdissection approach called mesodissection is a possible solution to the pitfalls of LCM. This technique employs the MESO-1/MeSectr system to mill the desired tissue from a slide mounted tissue sample while concurrently dispensing and aspirating fluid to recover the desired tissue sample into a consumable mill bit. Before the dissection process begins, the user aligns the formalin fixed paraffin embedded (FFPE) slide with a hematoxylin and eosin stained (H&#38;E) reference slide. Thereafter, the operator annotates the desired dissection area and proceeds to dissect the appropriate segment. The program generates an archived image of the dissection. The main advantage of mesodissection is the short duration needed to dissect a slide, taking an average of ten minutes from set up to sample generation in this experiment. Additionally, the system is significantly more cost effective and user friendly. A slight disadvantage is that it is not as precise as laser capture microscopy. In this article we demonstrate how mesodissection can be used to extract RNA from slides from FFPE granulomas caused by Mycobacterium tuberculosis (Mtb).

A Novel Microdissection Approach to Recovering Mycobacterium tuberculosis Specific Transcripts from Formalin Fixed Paraffin Embedded Lung Granulomas

Microdissection has been extensively employed for the examination of DNA, RNA, and protein within tissue. Laser capture microscopy (LCM) is the most commonly used method, but a new milling technique, mesodissection, is recently available. We demonstrate RNA extraction from mesodissected formalin fixed paraffin embedded tissue slides of Mycobacterium tuberculosis granulomas.

Microdissection has been used for the examination of tissues at DNA, RNA, and protein levels for over a decade. Laser capture microscopy (LCM) is the most ...

Identification of Rare Bacterial Pathogens by 16S rRNA Gene Sequencing and MALDI-TOF MS

There are a number of rare and, therefore, insufficiently described bacterial pathogens which are reported to cause severe infections especially in immunocompromised patients. In most cases only few data, mostly published as case reports, are available which investigate the role of such pathogens as an infectious agent. Therefore, in order to clarify the pathogenic character of such microorganisms, it is necessary to conduct epidemiologic studies which include large numbers of these bacteria. The methods used in such a surveillance study have to meet the following criteria: the identification of the strains has to be accurate according to the valid nomenclature, they should be easy to handle (robustness), economical in routine diagnostics and they have to generate comparable results among different laboratories. Generally, there are three strategies for identifying bacterial strains in a routine setting: 1) phenotypic identification characterizing the biochemical and metabolic properties of the bacteria, 2) molecular techniques such as 16S rRNA gene sequencing and 3) mass spectrometry as a novel proteome based approach. Since mass spectrometry and molecular approaches are the most promising tools for identifying a large variety of bacterial species, these two methods are described. Advances, limitations and potential problems when using these techniques are discussed.

Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) and molecular techniques (16S rRNA gene sequencing) permit the identification of rare bacterial pathogens in routine diagnostics. The goal of this protocol lies in the combination of both techniques which leads to more accurate and reliable data.

There are a number of rare and, therefore, insufficiently described bacterial pathogens which are reported to cause severe infections especially in ...

A Method for Targeted 16S Sequencing of Human Milk Samples

Studies of microbial communities have become widespread with the development of relatively inexpensive, rapid, and high throughput sequencing. However, as with all these technologies, reproducible results depend on a laboratory workflow that incorporates appropriate precautions and controls. This is particularly important with low-biomass samples where contaminating bacterial DNA can generate misleading results. This article details a semi-automated workflow to identify microbes from human breast milk samples using targeted sequencing of the 16S ribosomal RNA (rRNA) V4 region on a low- to mid-throughput scale. The protocol describes sample preparation from whole milk including: sample lysis, nucleic acid extraction, amplification of the V4 region of the 16S rRNA gene, and library preparation with quality control measures. Importantly, the protocol and discussion consider issues that are salient to the preparation and analysis of low-biomass samples including appropriate positive and negative controls, PCR inhibitor removal, sample contamination by environmental, reagent, or experimental sources, and experimental best practices designed to ensure reproducibility. While the protocol as described is specific to human milk samples, it is adaptable to numerous low- and high-biomass sample types, including samples collected on swabs, frozen neat, or stabilized in a preservation buffer.

A semi-automated workflow is presented for targeted sequencing of 16S rRNA from human milk and other low-biomass sample types.

Studies of microbial communities have become widespread with the development of relatively inexpensive, rapid, and high throughput sequencing. However, as ...