We wish to thank Monte Westerfield, Makoto Kobayashi and Jacek Topczewski for the gifts of plasmids for in situ hybridization and mRNA microinjections. We are grateful to Steph Erhard for appearing in the video. We also wish to acknowledge the assistance of William Goossens with the confocal microscopy shown in the video. Tyler Schwend provided images used in the video, and Rodney Dale assisted with preparation for the video. We also acknowledge the CMRC animal care staff for their husbandry work with the zebrafish. This work was funded by NIH grant R21 AA13596 to SCA.

1. Ethanol Treatment of Embryos
<ol>
 <li>Zebrafish embryos derived from wild-type matings were raised at 28 &deg;C in 5 ml of embryo water. (Milli-Q water with 60 mg/L Instant Ocean). Different strains of wild-type embryos have slightly different tolerances to ethanol exposure9.</li>
 <li>Exposure to ethanol was initiated at dome stage (~4.3 hours post fertilization, hpf) for the desired length of time, up to a 24 hr pulse. This starting stage is roughly equivalent to the implantation stage of mammalian embryos, just prior to gastrulation. Ethanol concentrations used range from 0.2%-2.5%, volume/volume. Tests have demonstrated that between 25-50% of the solution in the water ends up in the developing embryo10, 11. Embryos are maintained at 28 &deg;C for the desired length of time. After the desired length of ethanol exposure, the ethanol-water solution is removed and replaced with three washes of regular zebrafish water and maintained for the desired length of time. The specificity of the defect depends on the time of onset, the dose, and the length of the pulse of ethanol.</li>
</ol>
2. Collection of Embryos for RNA, in situ Hybridization, Antibody, and Cartilage Staining
<ol>
 <li>To collect mRNA for qPCR, age matched embryos are collected in eppendorf tubes. After removal of the zebrafish water, lysis buffer with TCEP is added. A motorized pulverizer is used to physically dissociate the embryos in the lysis solution. This is then passed through a preclear column, which removes any undissociated large pieces. The resulting solution contains all the macromolecules released by the lysis process. RNA is then extracted by running this solution on a column, followed by washes and DNAse treatment. Elution is then performed using either water or an elution solution provided by the manufacturer (5'-Prime). The RNA can be converted to cDNA using standard techniques for qPCR or used in microarray analysis.</li>
 <li>For in situ hybridization and antibody staining, embryos from 6 to 24 hpf were fixed in 4% paraformaldehyde overnight at 4 &deg;C. This is followed by 3 washes in PBS + 0.1% Tween (PBT), to keep embryos from sticking together. Embryos are then transferred through a series of 3 methanol:PBT washes into 100% methanol, at which point they can be stored at -20 &deg;C. These embryos can be used for in situ hybridization or antibody staining. Some antibodies do not work after methanol treatment, so this caveat needs to be taken into account and your specific antibody tested to determine if it will work after methanol treatment.</li>
 <li>For cartilage staining, embryos need to be raised to 5 or 6 days post fertilization (dpf). They are then fixed in 4% paraformaldehyde overnight at 4 &deg;C, followed by 3 washes in PBT.</li>
</ol>
3. Assessing Ethanol-induced Gene Expression Changes and Developmental Consequences
<ol>
 <li>To determine what gene expression levels have changed, targeted genes are examined by both qPCR and in situ hybridization. qPCR is achieved using primers designed with Integrated DNA Technologies (IDT) software, then validated using 3 separate biological samples. Once primers have been validated, qPCR is performed on cDNA created from collected RNA samples. Each sample is run in triplicate. PCR reactions are run Platinum SYBR Green qPCR Super mix (Invitrogen) on a Chroma-4 PCR machine (BioRad) or similar PCR machine with a multicolor detection system. In addition to the genes being interrogated, it is critical that a control set of primers is used to balance small differences in cDNA or RNA preparation. For our zebrafish embryos, we use gapdh: 5'GAAGGTGGGAAACTGGTCAT3' and 5'TTGCACCACCCTTAATGTGA3'. Genes being analyzed are then normalized to gapdh levels an the relative quantification of gene expression is calculated using the Pfaffl method variation on 2- Ct, displaying data as fold difference in experimental relative to wild type12. The normal calculation assumes that all genes are duplicating the DNA twice for every cycle, and thus expresses the data as a ratio of the change in the experimental gene over the change in the reference gene, expressed as power calculations over the integer "2", which is the efficiency of doubling of DNA per cycle seen in a perfect PCR reaction. The Pfaffl method replaces the generic "2" with the experimenter generated true efficiency for the PCR primers chosen. It reflects a more accurate reflection of the difference in the PCR reactions. The full formula is: 
 <table border="0">
 <tbody>
 <tr>
 <td>(Efficiency of experimental gene)(Ct of control sample-Ct of treated sample)</td>
 </tr>
 <tr>
 <td>-------------------------------------------------------------------------------------</td>
 </tr>
 <tr>
 <td>(Efficiency of reference gene)(Ct of control sample - Ct of treated sample)</td>
 </tr>
 </tbody>
 </table>
 </li>
 <li>For in situ hybridization, digoxigenin (dig) -labeled riboprobes are constructed from plasmids containing portions of the gene of interest. Age-matched embryos are exposed to riboprobes using standard conditions13 and detected using anti-dig antibodies coupled to Alkaline phosphatase which allows the location of the labeled riboprobes using a color reaction (NBT/BCIP). Embryos are then visualized using a Leica dissecting microscope (Figure 1B-G).</li>
 <li>To assess morphogenic development, embryos are collected at the desired time and examined under the dissecting microscope. For somite shape, live embryos are imaged 14. For inter ocular distance and body length, embryos are fixed in PFA. In all cases, images of the desired region are captured on a dissecting microscope at a fixed magnification and measurements taken using Adobe Photoshop software 10,14.</li>
 <li>To examine the effects of treatment on the developing cartilage structures in the larval zebrafish, we use Alcian Blue staining. Fixed zebrafish larvae are treated with Alcian blue solution dissolved in 80% ethanol: 20% glacial acetic acid (acid alcohol) for several hours or overnight. Larvae are destained in several washes of acid alcohol before being transferred to a 1% KOH: 3% hydrogen peroxide solution for further clearing of pigment cells. Zebrafish need to be at least 4 days old to show cartilage structures, and these are better defined in fish that are 5 or 6 days old.</li>
 <li>Cell death in living embryos is assessed using Acridine Orange (AO). AO is not cell permeable to living cells, and binds to DNA in cells with compromised membranes, including those undergoing apoptosis and necrosis. Living embryos are incubated with 5 mg/ml AO in PBS for 1 hour, followed by 3 washes in PBS. Embryos are then imaged using the confocal microscope. Digital Z-series images are combined to create composites.</li>
</ol>
4. Manipulating the Zebrafish Embryo
<ol>
 <li>After identification of genes which are decreased by ethanol exposure, it is possible to try to replace them using injection of mRNA designed to replace the missing gene. Capped mRNA is transcribed from linearized DNA plasmids using RNA polymerase in vitro transcription kits, according to the manufacturers instructions (mMessage Machine, Applied Biosystems). Between 25-200 pg/nl of RNA is injected into 1-2 cell stage zebrafish eggs, in a solution of 0.1 M KCl. Embryos are then allowed to recover before being treated with ethanol as described above (Figure 5).</li>
 <li>For any gene transcripts that are increased by ethanol exposure, they can be reduced, or "knocked-down" using an antisense morpholino technology. Antisense morpholinos (AMOs) are designed by the company Gene Tools, and block the translation of RNA into protein, or block the maturation and splicing of RNA, depending on the experimental need. This action of morpholinos limit the amount of active protein for the gene targeted, a deficit which can be measured using anitibodies if they are available. The efficiency of RNA splicing morpholinos can be measured using RT-PCR to detect the relative amounts of spliced and unspliced transcripts. Titrating of the morpholino can result in dose-dependent activity15. AMOs are diluted to working concentrations (titrated pg to ng concentration) in Danieau solution (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM Ca(NO3)2, 5 mM HEPES, pH 7.6). Injection takes place at the 1-2-cell stage, then the embryos are allowed to develop before being subjected to ethanol treatment as above.</li>
</ol>
5. Representative Results
Zebrafish embryo exposure to ethanol results in a number of developmental and genetic defects that are related to the phenotypes found in other vertebrates. We have documented abnormal development of axial tissues, including the notochord (data not shown14). The developmental delay produced by ethanol apparently leads to disruption of proper notochord elongation, leading to a shortened and occasionally disrupted notochord (data not shown14). This early delay and notochord defect likely leads in part to the later abnormalities in the somites (Figure 2), which have lost their strong chevron shape as seen in the untreated controls, and are closer to the u-shaped somites characteristic of phenotypes seen when sonic signaling is reduced14. The angle of the somites can be measured using standard software, and the angle increases from 92.1 &plusmn; 4.6&deg; in the untreated controls to 122.6 &plusmn; 6.6&deg; in the ethanol treated embryos (p &lt; 0.001).
Another consequence of ethanol exposure that might be downstream of early developmental delay and later notochord defects is a shortened length of the embryo (Figure 3). Even measuring embryos to take into account the curvature produced by ethanol exposure, ethanol exposure leads to a shortened trunk that is dependent on the dose of ethanol the embryo was exposed to (Figure 3E14) . This finding is similar to the persistence of prepuberty short stature found in children exposed to ethanol during development16, 17, suggesting that the zebrafish model is relevant for the understanding of the human birth defect.
One of the classic characteristics of FAS is a classic facies, including a reduced jaw, small eye opening, and a smooth philtrum. Much of these features are related to a reduction in the midline tissues. It has been demonstrated in animal models that severe ethanol exposure leads to even more pronounced phenotypes, including synopthalmia and cyclopia. When exposing zebrafish embryos to increased doses of ethanol, the intraocular distance (IOD) decreases in a dose dependent fashion (Figure 4) consistent with the nature of the human birth defect. Cyclopia is only found with very high doses, but lower doses do produce a significant reduction in the IOD (Figure 4), suggesting that this animal model has a similar defect in midline facial development10.
In order to understand the mechanism underlying the defects in both the body and face produced by ethanol exposure, we sought to establish gene expression changes that occur early in development and that might reasonably be expected to contribute to later developmental defects. We do this in two ways, the extraction of mRNA from embryos allows for a quantitative evaluation of the levels of gene expression in ethanol treated embryos compared to controls (Figure 1A). In addition, we can perform in situ hybridization to look at the pattern of genes, regardless of whether or not the signal is decreased (Figure 1B-G18). In this example, two genes whose expression is decreased after exposure to ethanol are shown, gli1and six3b. When we examined the in situ pattern for six3b, we did find a reduction in the spatial extent of the expression of this gene (Figure 1 E-G) in embryos exposed to ethanol. A similar reduction was found in the gene gsc (Figure B-D). Both six3b and gsc are expressed in tissues destined to contribute to craniofacial midline tissues. So reduction of these genes at 8 hpf is consistent with the reduction in IOD found later as shown in Figure 4.
Once genes that are affected by ethanol are identified, there are mechanisms by which the expression of them can be increased or decreased. In this particular example, we have shown 2 genes that are decreased (gli1 and six3b) by qPCR. We chose to inject mRNA to determine if reversing these gene changes can improve outcomes. For this experiment, instead of injecting gli1, we chose to inject shh, a ligand that increases gli1 levels. For six3b, we were able to inject six3b itself. We found no changes when we injected six3b (data not shown) but were able to fundamentally rescue the gross defects in zebrafish embryos with supplemental shh injections (Figure 5).
<img alt="Figure 1" src="/files/ftp_upload/3704/3704fig1.jpg" /> 
Figure 1. Ethanol exposure changes the early pattern and gene expression levels of selected developmental genes. A) qPCR results for embryos at 8hpf. The results for two genes are displayed: six3b and gli1. Results shown as average of three separate experiments, and the dose of ethanol shown is 2.5%. Both genes are reduced in a manner that is significant from control (t-test, p &lt; 0.05). B-G) In situ hybridization of 8 hpf zebrafish embryos. Both gsc and six3b patterns are altered at this time point compared to controls. (Modified with permission from Loucks et al. 2007).
<img alt="Figure 2" src="/files/ftp_upload/3704/3704fig2.jpg" /> 
Figure 2. Somite development is altered in treated embryos. Somite structure and angles are examined at 48 hpf. In control embryos (A), somites have a chevron shape and a sharp angle. Ethanol exposed zebrafish have more I- or U- shaped somites, and less sharp angles. (Modified with permission from Loucks and Ahlgren 2009).
<img alt="Figure 3" src="/files/ftp_upload/3704/3704fig3.jpg" /> 
Figure 3. Ethanol treatment significantly decreases body length in zebrafish. The length of untreated and ethanol-exposed embryos were measured at 5 days postfertilization. A significant reduction in length was seen in all treated embryos (ANOVA, p &lt; 0.001). B-D. There was a slight but significant reduction in the total length of embryos treated with 1.0% and 1.5% ethanol, whereas a greater reduction was seen in embryos dosed with 2.0% and 2.5% ethanol. E. To control for size differences in each clutch, the control embryos for each experiment were normalized to 100, and sibling treated embryos expressed as a percentage of 100. (Modified with permission from Loucks and Ahlgren 2009).
<img alt="Figure 4" src="/files/ftp_upload/3704/3704fig4.jpg" /> 
Figure 4. Ethanol exposure results in a reduction in the intraocular distance (iod) in zebrafish embryos. A) frontal views of embryos demonstrate normal and fused eye phenotypes. B) Differing doses of ethanol administered for 3 hours during gastrulation results in decreased iod when fish are examined 24 hours later. Fused eyes and cyclopia are only seen at the highest dose tested (2.4%). * denotes a significant reduction in iod compared to controls. (modified with permission from Ahlgren, 2004).
<img alt="Figure 5" src="/files/ftp_upload/3704/3704fig5.jpg" /> 
Figure 5. shh-NmRNA injection rescues the gross defects produced by ethanol exposure of zebrafish. One-two cell embryos were injected with 100 pg/nl shh-NmRNA and half of the injected embryos were exposed to the standard ethanol doses from 4.3 to 24 hpf. Embryos were analyzed at 5 dpf. Embryos treated with 2.0% ethanol exhibit dorsally curved shorter tails, I-shaped somites, and eye defects including cyclopia. Rescue of these phenotypes is seen in 71/76 of injected embryos (93%). In these embryos, the body is straight, the somites are chevron shaped, and the eyes are completely separated.

<ol>
	<li>Streissguth, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fetal+alcohol+syndrome+in+adolescents+and+adults.">Fetal alcohol syndrome in adolescents and adults.</a> Jama. 265 (15), 1961-1967 (1991).</li><li>Floyd, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Observations+from+the+CDC.+Preventing+alcohol-exposed+pregnancies+among+women+of+childbearing+age:+the+necessity+of+a+preconceptional+approach.">Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach.</a> J. Womens Health Gend. Based Med. 8 (6), 733-736 (1999).</li><li>Ali, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+analysis+of+acute+ethanol+exposure+in+zebrafish+development:+a+critical+time+window+and+resilience.">Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience.</a> PLoS One. 6 (5), e20037-e20037 (2011).</li><li>Dlugos, C. A., Rabin, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+functional+effects+of+developmental+exposure+to+ethanol+on+the+zebrafish+heart.">Structural and functional effects of developmental exposure to ethanol on the zebrafish heart.</a> Alcohol Clin. Exp. Res. 34 (6), 1013-1021 (2010).</li><li>Fernandes, Y., Gerlai, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+behavioral+changes+in+response+to+early+developmental+exposure+to+ethanol+in+zebrafish.">Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish.</a> Alcohol Clin. Exp. Res. 33 (4), 601-609 (2009).</li><li>Bilotta, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+embryonic+exposure+to+ethanol+on+zebrafish+visual+function.">Effects of embryonic exposure to ethanol on zebrafish visual function.</a> Neurotoxicol. Teratol. 24 (6), 759-766 (2002).</li><li>Tanguay, R. L., Reimers, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+ethanol+developmental+toxicity+in+zebrafish.">Analysis of ethanol developmental toxicity in zebrafish.</a> Methods Mol. Biol. 447, 63-74 (2008).</li><li>Blader, P., Strahle, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ethanol+impairs+migration+of+the+prechordal+plate+in+the+zebrafish+embryo.">Ethanol impairs migration of the prechordal plate in the zebrafish embryo.</a> Dev. Biol. 201 (2), 185-201 (1998).</li><li>Loucks, E., Carvan, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3rd,+Strain-dependent+effects+of+developmental+ethanol+exposure+in+zebrafish.">3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish.</a> Neurotoxicol. Teratol. 26 (6), 745-755 (2004).</li><li>Ahlgren, S. C., Preedy, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+Mechanisms+of+Fetal+Alcohol+Syndrome:+Shh-signaling.">Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling.</a> Comprehensive Handbook of Alcohol Related Pathology. , (2004).</li><li>Reimers, M. J., Flockton, A. R., Tanguay, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ethanol-+and+acetaldehyde-mediated+developmental+toxicity+in+zebrafish.">Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish.</a> Neurotoxicol. Teratol. 26 (6), 769-781 (2004).</li><li>Pfaffl, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+mathematical+model+for+relative+quantification+in+real-time+RT-PCR.">A new mathematical model for relative quantification in real-time RT-PCR.</a> Nucleic Acids Res. 29 (9), 45-45 (2001).</li><li>Jowett, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Tissue in situ hybridization: methods in animal development. , 128-128 (1997).</li><li>Loucks, E. J., Ahlgren, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deciphering+the+role+of+Shh+signaling+in+axial+defects+produced+by+ethanol+exposure.">Deciphering the role of Shh signaling in axial defects produced by ethanol exposure.</a> Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).</li><li>Schwend, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Requirement+of+Npc1+and+availability+of+cholesterol+for+early+embryonic+cell+movements+in+zebrafish.">Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish.</a> J. Lipid Res. 52 (7), 1328-1344 (2011).</li><li>Spohr, H. L., Willms, J., Steinhausen, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fetal+alcohol+spectrum+disorders+in+young+adulthood.">Fetal alcohol spectrum disorders in young adulthood.</a> J. Pediatr. 150 (2), 175-179 (2007).</li><li>Strauss, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+the+intrauterine+environment+on+childhood+growth.">Effects of the intrauterine environment on childhood growth.</a> Br. Med. Bull. 53 (1), 81-95 (1997).</li><li>Loucks, E. J., Schwend, T., Ahlgren, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+changes+associated+with+teratogen-induced+cyclopia.">Molecular changes associated with teratogen-induced cyclopia.</a> Birth Defects Res. A. Clin. Mol. Teratol. 79 (9), 642-651 (2007).</li><li>Schwend, T., Loucks, E. J., Ahlgren, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+Gli+activity+in+craniofacial+tissues+of+hedgehog-pathway+reporter+transgenic+zebrafish.">Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish.</a> PLoS One. 5 (9), 14396-14396 (2011).</li><li>Chrisman, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gestational+ethanol+exposure+disrupts+the+expression+of+FGF8+and+Sonic+hedgehog+during+limb+patterning.">Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning.</a> Birth Defects Res. A. Clin. Mol. Teratol. 70 (4), 163-171 (2004).</li></ol>

We have nothing to disclose.

The methods described here and the results shown demonstrate just the tip of how zebrafish can be used to interrogate developmental defects. Because of the accessibility of the embryo, high number of eggs laid for each clutch, and high reproducibility of the results, these vertebrates are ideal for teratogenic studies. Fish can also be manipulated to contain fluorescent molecules to use as a visual reporter for a particular gene or pathway of interest19. In the ethanol studies, the doses used appear quite high compared to mammalian blood alcohol levels. However, these levels reflect what is present in the water, and not all of the ethanol is delivered to the embryo.
Taken together, the methods described and detailed above suggest that zebrafish embryos are highly useful in modeling human birth defects related to ethanol exposure. Furthermore, the gene expression changes found in the zebrafish have been confirmed by others in the mammalian model systems20, suggesting that the developmental effects of ethanol are retained across vertebrates. Many of the techniques demonstrated above can be used with other environmental or pharmaceutical insults to quickly and easily detect potential teratogens and determine the underlying mechanisms that contribute to the teratogenesis of a particular substance.

<table border="1">
<tbody>
 <tr>
 <td>Name of the reagent</td>
 <td>Company</td>
 <td>Catalogue number</td>
 </tr>
 <tr>
 <td>Tissue RNA kit: 5-Prime PerfectPure</td>
 <td> Fisher Scientific</td>
 <td>FP2302410</td>
 </tr>
 <tr>
 <td>Platinum SYBR green qPCR SuperMix-UDG</td>
 <td>Invitrogen</td>
 <td>11733038</td>
 </tr>
 <tr>
 <td>mMessage mMachine high yield capped RNA transcription kit</td>
 <td>Applied Biosystems</td>
 <td>Depends on the RNA polymerase in your plasmid</td>
 </tr>
</tbody>
</table>

assessing teratogenic changes in a zebrafish model of fetal alcohol exposure

Fetal alcohol syndrome (FAS) is a severe manifestation of embryonic exposure to ethanol. It presents with characteristic defects to the face and organs, including mental retardation due to disordered and damaged brain development. Fetal alcohol spectrum disorder (FASD) is a term used to cover a continuum of birth defects that occur due to maternal alcohol consumption, and occurs in approximately 4% of children born in the United States. With 50% of child-bearing age women reporting consumption of alcohol, and half of all pregnancies being unplanned, unintentional exposure is a continuing issue2. In order to best understand the damage produced by ethanol, plus produce a model with which to test potential interventions, we developed a model of developmental ethanol exposure using the zebrafish embryo. Zebrafish are ideal for this kind of teratogen study3-8. Each pair lays hundreds of eggs, which can then be collected without harming the adult fish. The zebrafish embryo is transparent and can be readily imaged with any number of stains. Analysis of these embryos after exposure to ethanol at different doses and times of duration and application shows that the gross developmental defects produced by ethanol are consistent with the human birth defect. Described here are the basic techniques used to study and manipulate the zebrafish FAS model.

Watch this Scientific Journal Video about Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure at JoVE.com

Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure

In order to understand the molecular mechanisms of the ethanol-induced developmental damage, we have developed a zebrafish model of ethanol exposure and are exploring the physical, cellular, and genetic alterations that occur after ethanol exposure1. We then seek to find potential interventions and rapidly test them in this animal model.

Fetal alcohol syndrome (FAS) is a severe manifestation of embryonic exposure to ethanol. It presents with characteristic defects to the face and organs, ...

assessing-teratogenic-changes-zebrafish-model-fetal-alcohol

Research

JoVE Journal

Medicine

26.2K vistas.  Children's Memorial Research Center. A fin de comprender los mecanismos moleculares de los daños en el desarrollo inducido por etanol, hemos desarrollado un modelo de pez cebra de la exposición de etanol y están explorando las alteraciones físicas, celulares y genéticos que se producen después de la exposición de etanol 1. A continuación, tratan de encontrar las posibles intervenciones y rápidamente ponerlos a prueba en este modelo animal.

Video: Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure

The Polyvinyl Alcohol Sponge Model Implantation

Wound healing is a complicated, multistep process involving many cell types, growth factors and compounds1-3. Because of this complexity, wound healing studies are most comprehensive when carried out in vivo. There are many in vivo models available to study acute wound healing, including incisional, excisional, dead space, and burns. Dead space models are artificial, porous implants which are used to study tissue formation and the effects of substances on the wound. Some of the commonly used dead space models include polyvinyl alcohol (PVA) sponges, steel wire mesh cylinders, expanded polytetrafluoroethylene (ePTFE) material, and the Cellstick1,2.
Each dead space model has its own limitations based on its material's composition and implantation methods. The steel wire mesh cylinder model has a lag phase of infiltration after implantation and requires a long amount of time before granulation tissue formation begins1. Later stages of wound healing are best analyzed using the ePTFE model1,4. The Cellstick is a cellulose sponge inside a silicon tube model which is typically used for studying human surgery wounds and wound fluid2. The PVA sponge is limited to acute studies because with time it begins to provoke a foreign body response which causes a giant cell reaction in the animal5. Unlike other materials, PVA sponges are easy to insert and remove, made of inert and non-biodegradable materials and yet are soft enough to be sectioned for histological analysis2,5.
In wound healing the PVA sponge is very useful for analyzing granulation tissue formation, collagen deposition, wound fluid composition, and the effects of substances on the healing process1,2,5. In addition to its use in studying a wide array of attributes of wound healing, the PVA sponge has also been used in many other types of studies. It has been utilized to investigate tumor angiogenesis, drug delivery and stem cell survival and engraftment1,2,6,7. With its great alterability, prior extensive use, and reproducible results, the PVA sponge is an ideal model for many studies1,2.
Here, we will describe the preparation, implantation and retrieval of PVA sponge disks (Figure 1) in a mouse model of wound healing.

A useful tool to analyze the effects of drugs, growth factors, and/or manipulated cells in an animal model of wound repair is described. This technique utilizes the properties of a polyvinyl alcohol (PVA) sponge to deliver and contain the desired treatment and also provide a platform to be excised and analyzed.

Wound healing is a complicated, multistep process involving many cell types, growth factors and compounds1-3. Because of this complexity, wound healing ...

A Novel Surgical Approach for Intratracheal Administration of Bioactive Agents in a Fetal Mouse Model

Prenatal pulmonary delivery of cells, genes or pharmacologic agents could provide the basis for new therapeutic strategies for a variety of genetic and acquired diseases. Apart from congenital or inherited abnormalities with the requirement for long-term expression of the delivered gene, several non-inherited perinatal conditions, where short-term gene expression or pharmacological intervention is sufficient to achieve therapeutic effects, are considered as potential future indications for this kind of approach. Candidate diseases for the application of short-term prenatal therapy could be the transient neonatal deficiency of surfactant protein B causing neonatal respiratory distress syndrome1,2 or hyperoxic injuries of the neonatal lung3. Candidate diseases for permanent therapeutic correction are Cystic Fibrosis (CF)4, genetic variants of surfactant deficiencies5 and &alpha;1-antitrypsin deficiency6.
Generally, an important advantage of prenatal gene therapy is the ability to start therapeutic intervention early in development, at or even prior to clinical manifestations in the patient, thus preventing irreparable damage to the individual. In addition, fetal organs have an increased cell proliferation rate as compared to adult organs, which could allow a more efficient gene or stem cell transfer into the fetus. Furthermore, in utero gene delivery is performed when the individual's immune system is not completely mature. Therefore, transplantation of heterologous cells or supplementation of a non-functional or absent protein with a correct version should not cause immune sensitization to the cell, vector or transgene product, which has recently been proven to be the case with both cellular and genetic therapies7.
In the present study, we investigated the potential to directly target the fetal trachea in a mouse model. This procedure is in use in larger animal models such as rabbits and sheep8, and even in a clinical setting9, but has to date not been performed before in a mouse model. When studying the potential of fetal gene therapy for genetic diseases such as CF, the mouse model is very useful as a first proof-of-concept because of the wide availability of different transgenic mouse strains, the well documented embryogenesis and fetal development, less stringent ethical regulations, short gestation and the large litter size.
Different access routes have been described to target the fetal rodent lung, including intra-amniotic injection10-12, (ultrasound-guided) intrapulmonary injection13,14 and intravenous administration into the yolk sac vessels15,16 or umbilical vein17. Our novel surgical procedure enables researchers to inject the agent of choice directly into the fetal mouse trachea which allows for a more efficient delivery to the airways than existing techniques18.

We developed a novel surgical approach for intratracheal administration of bioactive agents into the mouse fetus. The delivery route is more efficient in targeting the fetal mouse lungs than the commonly used intra-amniotic injection. This procedure has to date not been described in a mouse model.

Prenatal pulmonary delivery of cells, genes or pharmacologic agents could provide the basis for new therapeutic strategies for a variety of genetic and ...

Screening for Melanoma Modifiers using a Zebrafish Autochthonous Tumor Model

Genomic studies of human cancers have yielded a wealth of information about genes that are altered in tumors1,2,3. A challenge arising from these studies is that many genes are altered, and it can be difficult to distinguish genetic alterations that drove tumorigenesis from that those arose incidentally during transformation. To draw this distinction it is beneficial to have an assay that can quantitatively measure the effect of an altered gene on tumor initiation and other processes that enable tumors to persist and disseminate. Here we present a rapid means to screen large numbers of candidate melanoma modifiers in zebrafish using an autochthonous tumor model4 that encompasses steps required for melanoma initiation and maintenance. A key reagent in this assay is the miniCoopR vector, which couples a wild-type copy of the mitfa melanocyte specification factor to a Gateway recombination cassette into which candidate melanoma genes can be recombined5. The miniCoopR vector has a mitfa rescuing minigene which contains the promoter, open reading frame and 3'-untranslated region of the wild-type mitfa gene. It allows us to make constructs using full-length open reading frames of candidate melanoma modifiers. These individual clones can then be injected into single cell Tg(mitfa:BRAFV600E);p53(lf);mitfa(lf)zebrafish embryos. The miniCoopR vector gets integrated by Tol2-mediated transgenesis6 and rescues melanocytes. Because they are physically coupled to the mitfa rescuing minigene, candidate genes are expressed in rescued melanocytes, some of which will transform and develop into tumors. The effect of a candidate gene on melanoma initiation and melanoma cell properties can be measured using melanoma-free survival curves, invasion assays, antibody staining and transplantation assays.

A rapid way to screen for melanoma modifiers using a zebrafish autochthonous tumor model is presented. It takes advantage of the miniCoopR vector which allows for expression of candidate melanoma genes in melanocytes. A method to obtain melanoma-free survival curves, an invasion assay, a protocol for antibody staining of scale melanocytes and a melanoma transplantation assay are described.

Genomic studies of  human cancers have yielded a wealth of information about genes that are altered  in tumors1,2,3. A challenge arising from these ...

Fetal Echocardiography and Pulsed-wave Doppler Ultrasound in a Rabbit Model of Intrauterine Growth Restriction

Fetal intrauterine growth restriction (IUGR) results in abnormal cardiac function that is apparent antenatally due to advances in fetoplacental Doppler ultrasound and fetal echocardiography. Increasingly, these imaging modalities are being employed clinically to examine cardiac function and assess wellbeing in utero, thereby guiding timing of birth decisions. Here, we used a rabbit model of IUGR that allows analysis of cardiac function in a clinically relevant way. Using isoflurane induced anesthesia, IUGR is surgically created at gestational age day 25 by performing a laparotomy, exposing the bicornuate uterus and then ligating 40-50% of uteroplacental vessels supplying each gestational sac in a single uterine horn. The other horn in the rabbit bicornuate uterus serves as internal control fetuses. Then, after recovery at gestational age day 30 (full term), the same rabbit undergoes examination of fetal cardiac function. Anesthesia is induced with ketamine and xylazine intramuscularly, then maintained by a continuous intravenous infusion of ketamine and xylazine to minimize iatrogenic effects on fetal cardiac function. A repeat laparotomy is performed to expose each gestational sac and a microultrasound examination (VisualSonics VEVO 2100) of fetal cardiac function is performed. Placental insufficiency is evident by a raised pulsatility index or an absent or reversed end diastolic flow of the umbilical artery Doppler waveform. The ductus venosus and middle cerebral artery Doppler is then examined. Fetal echocardiography is performed by recording B mode, M mode and flow velocity waveforms in lateral and apical views. Offline calculations determine standard M-mode cardiac variables, tricuspid and mitral annular plane systolic excursion, speckle tracking and strain analysis, modified myocardial performance index and vascular flow velocity waveforms of interest. This small animal model of IUGR therefore affords examination of in utero cardiac function that is consistent with current clinical practice and is therefore useful in a translational research setting.

We describe examination of fetal cardiac function with contemporary functional fetal echocardiography and fetoplacental Doppler ultrasound using the VisualSonics VEVO 2100 microultrasound in a surgically induced model of intrauterine fetal growth restriction in a rabbit.

Fetal intrauterine growth restriction (IUGR) results in abnormal cardiac function that is apparent antenatally due to advances in fetoplacental Doppler ...

Assessing Changes in Volatile General Anesthetic Sensitivity of Mice after Local or Systemic Pharmacological Intervention

One desirable endpoint of general anesthesia is the state of unconsciousness, also known as hypnosis. Defining the hypnotic state in animals is less straightforward than it is in human patients. A widely used behavioral surrogate for hypnosis in rodents is the loss of righting reflex (LORR), or the point at which the animal no longer responds to their innate instinct to avoid the vulnerability of dorsal recumbency. We have developed a system to assess LORR in 24 mice simultaneously while carefully controlling for potential confounds, including temperature fluctuations and varying gas flows. These chambers permit reliable assessment of anesthetic sensitivity as measured by latency to return of the righting reflex (RORR) following a fixed anesthetic exposure. Alternatively, using stepwise increases (or decreases) in anesthetic concentration, the chambers also enable determination of a population's sensitivity to induction (or emergence) as measured by EC50 and Hill slope. Finally, the controlled environmental chambers described here can be adapted for a variety of alternative uses, including inhaled delivery of other drugs, toxicology studies, and simultaneous real-time monitoring of vital signs.

Loss of the righting reflex has long served as a standard behavioral surrogate for unconsciousness, also called hypnosis, in laboratory animals. Alterations in volatile anesthetic sensitivity caused by pharmacological interventions can be detected with a carefully controlled high-throughput assessment system, which may be adapted for delivery of any inhaled therapeutic.

One desirable endpoint of general anesthesia is  the state of unconsciousness, also known as hypnosis. Defining the hypnotic state in animals is  less ...

A Possible Zebrafish Model of Polycystic Kidney Disease: Knockdown of wnt5a Causes Cysts in Zebrafish Kidneys

Polycystic kidney disease (PKD) is one of the most common causes of end-stage kidney disease, a devastating disease for which there is no cure. The molecular mechanisms leading to cyst formation in PKD remain somewhat unclear, but many genes are thought to be involved. Wnt5a is a non-canonical glycoprotein that regulates a wide range of developmental processes. Wnt5a works through the planar cell polarity (PCP) pathway that regulates oriented cell division during renal tubular cell elongation. Defects of the PCP pathway have been found to cause kidney cyst formation. Our paper describes a method for developing a zebrafish cystic kidney disease model by knockdown of the wnt5a gene with wnt5a antisense morpholino (MO) oligonucleotides. Tg(wt1b:GFP) transgenic zebrafish were used to visualize kidney structure and kidney cysts following wnt5a knockdown. Two distinct antisense MOs (AUG - and splice-site) were used and both resulted in curly tail down phenotype and cyst formation after wnt5a knockdown. Injection of mouse Wnt5a mRNA, resistant to the MOs due to a difference in primary base pair structure, rescued the abnormal phenotype, demonstrating that the phenotype was not due to &#8220;off-target&#8221; effects of the morpholino. This work supports the validity of using a zebrafish model to study wnt5a function in the kidney.

A Possible Zebrafish Model of Polycystic Kidney Disease: Knockdown of wnt5a Causes Cysts in Zebrafish Kidneys

We describe a method of generating a possible zebrafish model of polycystic kidney disease. We used Tg(wt1b:GFP) fish to visualize kidney structure. Knockdown of wnt5a was by morpholino injection. Pronephric cyst formation after wnt5a knockdown was observed in this GFP transgenic zebrafish.

Polycystic kidney disease (PKD) is one of the most common causes of end-stage kidney disease, a devastating disease for which there is no cure. The ...

A Mouse Fetal Skin Model of Scarless Wound Repair

Early in utero, but not in postnatal life, cutaneous wounds undergo regeneration and heal without formation of a scar. Scarless fetal wound healing occurs across species but is age dependent. The transition from a scarless to scarring phenotype occurs in the third trimester of pregnancy in humans and around embryonic day 18 (E18) in mice. However, this varies with the size of the wound with larger defects generating a scar at an earlier gestational age. The emergence of lineage tracing and other genetic tools in the mouse has opened promising new avenues for investigation of fetal scarless wound healing. However, given the inherently high rates of morbidity and premature uterine contraction associated with fetal surgery, investigations of fetal scarless wound healing in vivo require a precise and reproducible surgical model. Here we detail a reliable model of fetal scarless wound healing in the dorsum of E16.5 (scarless) and E18.5 (scarring) mouse embryos.

During mammalian development, early gestational skin wounds heal without a scar. Here we detail a reliable and reproducible model of fetal scarless wound healing in the cutaneous dorsum of E16.5 (scarless) and E18.5 (scarring) mouse embryos.

Early in utero, but not in postnatal life, cutaneous wounds undergo regeneration and heal without formation of a scar. Scarless fetal wound healing occurs ...

Generation of a Chronic Obstructive Pulmonary Disease Model in Mice by Repeated Ozone Exposure

Chronic obstructive pulmonary disease (COPD) is characterized by persistent airflow limitation and lung parenchymal destruction. It has a very high incidence in aging populations. The current conventional therapies for COPD focus mainly on symptom-modifying drugs; thus, the development of new therapies is urgently needed. Qualified animal models of COPD could help to characterize the underlying mechanisms and can be used for new drug screening. Current COPD models, such as lipopolysaccharide (LPS) or the porcine pancreatic elastase (PPE)-induced emphysema model, generate COPD-like lesions in the lungs and airways but do not otherwise resemble the pathogenesis of human COPD. A cigarette smoke (CS)-induced model remains one of the most popular because it not only simulates COPD-like lesions in the respiratory system, but it is also based on one of the main hazardous materials that causes COPD in humans. However, the time-consuming and labor-intensive aspects of the CS-induced model dramatically limit its application in new drug screening. In this study, we successfully generated a new COPD model by exposing mice to high levels of ozone. This model demonstrated the following: 1) decreased forced expiratory volume 25, 50, and 75/forced vital capacity (FEV25/FVC, FEV50/FVC, and FEV75/FVC), indicating the deterioration of lung function; 2) enlarged lung alveoli, with lung parenchymal destruction; 3) reduced fatigue time and distance; and 4) increased inflammation. Taken together, these data demonstrate that the ozone exposure (OE) model is a reliable animal model that is similar to humans because ozone overexposure is one of the etiological factors of COPD. Additionally, it only took 6 - 8 weeks, based on our previous work, to create an OE model, whereas it requires 3 - 12 months to induce the cigarette smoke model, indicating that the OE model might be a good choice for COPD research.

This study describes the successful generation of a new chronic obstructive pulmonary disease (COPD) animal model by repeatedly exposing mice to high concentrations of ozone.

Chronic obstructive pulmonary disease (COPD) is characterized by persistent airflow limitation and lung parenchymal destruction. It has a very high ...

Model Surgical Training: Skills Acquisition in Fetoscopic Laser Photocoagulation of Monochorionic Diamniotic Twin Placenta Using Realistic Simulators

Fetoscopic laser coagulation of arterio-venous anastomoses (AVA) in a monochorionic placenta is the standard of care for twin-twin transfusion syndrome (TTTS), but is technically challenging and can lead to significant complications. Acquiring and maintaining the necessary surgical skills require consistent practice, a critical caseload, and time. Training on realistic surgical simulators can potentially shorten this steep learning curve and enables several proceduralists to acquire procedure-specific skills simultaneously. Here we describe realistic simulators designed to allow the user familiarity with the equipment and specific steps required in the surgical treatment of TTTS, including fetoscopic handling, approaches to anterior and posterior placenta, recognition of anastomoses, and efficient coagulation of vessels. We describe the skills that are especially important in conducting placental laser coagulation that the surgeon can practice on the model and apply in a clinical case. These models can be adapted easily depending on the availability of materials and require standard fetoscopy equipment. Such training systems are complementary to traditional surgical apprenticeships and can be useful aids for fetal medicine units that provide this clinical service.

Practicing the specific skills required for fetoscopic laser coagulation of monochorionic placental anastomoses on realistic models can aid less experienced surgeons in overcoming the steep learning curve associated with this procedure that is now regarded as the standard of care for twin-twin transfusion syndrome.

Fetoscopic laser coagulation of arterio-venous anastomoses (AVA) in a monochorionic placenta is the standard of care for twin-twin transfusion syndrome ...

A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish

The genetically accessible adult zebrafish (Danio rerio) has been increasingly used as a vertebrate model for understanding human diseases such as cardiomyopathy. Because of its convenience and amenability to high throughput genetic manipulations, the generation of acquired cardiomyopathy models, such as the doxorubicin-induced cardiomyopathy (DIC) model in adult zebrafish, is opening the doors to new research avenues, including discovering cardiomyopathy modifiers via forward genetic screening. Different from the embryonic zebrafish DIC model, both initial acute and later chronic phases of cardiomyopathy can be determined in the adult zebrafish DIC model, enabling the study of stage-dependent signaling mechanisms and therapeutic strategies. However, variable results can be obtained with the current model, even in the hands of experienced investigators. To facilitate future implementation of the DIC model, we present a detailed protocol on how to generate this DIC model in adult zebrafish and describe two alternative ways of intraperitoneal (IP) injection. We further discuss options on how to reduce variations to obtain reliable results and provide suggestions on how to appropriately interpret the results.

A method to generate a doxorubicin-induced cardiomyopathy model in adult zebrafish (Danio rerio) is described here. Two alternative ways of intraperitoneal injection are presented and conditions to reduce variations among different experimental groups are discussed.