This work was supported by funding from the Murdoch Childrens Research Institute and the Victorian Government&rsquo;s Operational Infrastructure Support Program.

1. Preparation of Epithelial and Bacterial Cells
<ol>
	<li>Thawing of CCL-23 epithelial cells
	<ol>
		<li>Prewarm Minimum Essential Media (MEM) containing 10% Fetal Bovine Serum (FBS) in a 37 &#176;C water bath for ~30 min.</li>
		<li>Sterilize the tissue culture-approved biosafety cabinet with UV light for at least 10 min before use, and wipe down the work area with 70% ethanol. Wipe the warmed media bottle with 70% ethanol and place in biosafety cabinet.</li>
		<li>Using a 25 ml pipette, transfer 14 ml of media into a T-75 flask. Place flask in 37 &#176;C incubator whilst cells are thawing (section 1.1.4).</li>
		<li>Remove a vial of CCL-23 cells from liquid nitrogen storage using appropriate safety precautions and warm in a 37 &#176;C water bath until ~80% thawed.</li>
		<li>Return the flask prepared in section 1.1.3 to the biosafety cabinet. Wipe outer surface of vial of CCL-23 cells with 70% ethanol and transfer contents (1 ml) into the T-75 flask using a P1000 pipette.</li>
		<li>Incubate the flask on its side in a 37 &#176;C, 5% CO2, 95% relative humidity tissue culture incubator overnight (16-20 hr).</li>
		<li>Check the cells under a microscope to confirm a healthy morphology, remove media, and replace with 15 ml fresh, prewarmed MEM + 10% FBS.</li>
	</ol>
	</li>
	<li>Maintenance of CCL-23 epithelial cells
	<ol>
		<li>Once cells are ~80% confluent (1-2 days), passage by removing media using a 25 ml pipette and gently wash the cells twice with 8-10 ml prewarmed phosphate buffered saline (PBS) using a 10 ml pipette.</li>
		<li>Remove PBS and add 1 ml of sterile 0.25% trypsin-EDTA (0.25% (w/v) trypsin, 0.1 mM EDTA). Turn flask on its side, rotate to ensure trypsin covers the confluent layer of cells, and incubate the flask for 2-3 min in the 37 &#176;C, 5% CO2 incubator.</li>
		<li>Return flask to the biosafety cabinet, add 9 ml prewarmed MEM + 10% FBS, and pipette up and down 6-8x to resuspend the cells, ejecting liquid down the side of the flask to dislodge cells.</li>
		<li>Split cells 1:15 (1 ml + 14 ml MEM + 10% FBS) or 1:30 (0.5 ml + 14.5 ml MEM + 10% FBS), discard excess cells, and return flask to the 37 &#176;C, 5% CO2 incubator.</li>
		<li>Passage the cells at least twice before use in the adherence assay. Typically cells are split every 3-4 days.</li>
	</ol>
	</li>
	<li>Seeding of CCL-23 epithelial cells (one day prior to adherence assay, Protocol&#160;2)
	<ol>
		<li>Split confluent cells as described in sections&#160;1.2.1-1.2.3, resuspending in prewarmed MEM + 5% FBS (FBS concentration is lowered to reduce the likelihood of serum components interfering in the assay). Remove 20 &#956;l of cells and count using trypan blue staining and a hemocytometer.</li>
		<li>Dilute cells in prewarmed MEM + 5% FBS to a concentration of 1.5 x 105 cells/ml in a sterile 50 ml tube.</li>
		<li>Seed 1 ml of cells/well in a tissue-culture treated 24-well plate.</li>
	</ol>
	</li>
	<li>Preparation of bacteria 
	This procedure can be followed for preparation of pneumococci and S. salivarius. Bacterial growth media is typically kept in a 37 &#176;C incubator overnight to prewarm and test for sterility (generally will appear cloudy if contaminated).
	<ol>
		<li>Two days prior to adherence assay, streak bacteria on horse blood agar (HBA) plates and incubate at 35-37 &#176;C and 5% CO2 for 18-24 hr. Sheep blood agar can be used as an alternative.</li>
		<li>The following day, prepare an overnight culture for each bacterial species by pipetting 10 ml Todd-Hewitt Broth with 0.5% yeast extract (THB+YE) medium into a sterile 30 ml tube. Using a 10 &#956;l loop, inoculate approximately 10-12 well separated colonies. Briefly vortex and incubate at 35-37 &#176;C and 5% CO2 for 14-16 hr. Note that pneumococci will autolyze if left too long in broth culture.</li>
	</ol>
	</li>
</ol>
2. Adherence Assay: Addition of Bacteria to Epithelial Cell Monolayers
<ol>
	<li>Preparation of mid-log bacterial cultures of pneumococci and S. salivarius
	<ol>
		<li>Pipette 10 ml of prewarmed THB+YE into each of two sterile 30 ml tubes, one labeled pneumococci and the other S. salivarius.</li>
		<li>To reach mid-log phase, pneumococci require ~3 hr and S. salivarius require ~2 hr incubation (see Figure 1). Start both cultures at the same time. Vortex (3-5 sec) overnight bacterial cultures and add 100 &#956;l pneumococci and 100 &#956;l S. salivarius into corresponding tubes.</li>
		<li>Briefly vortex and incubate the cultures at 37 &#176;C for approximately 2 hr for S. salivarius and 3 hr for pneumococci.</li>
	</ol>
	</li>
	<li>Preparation of CCL-23 cells for adherence assay
	<ol>
		<li>Using an inverted microscope, check the 24-well plate for confluent monolayers with healthy cell morphology. Monolayers should be &#62;80% confluent, without evidence of cell clumping or cytopathic effects such as cell rounding or loss of adherence (see Figure 2).</li>
		<li>Remove the media in each well using a transfer pipette, tilting the plate slightly to avoid disturbing the cell monolayer.</li>
		<li>To gently wash the cells, add ~500 &#956;l prewarmed PBS into each well using a serological pipette and remove it with a transfer pipette, tilting the plate slightly. Discard the PBS. Repeat wash step once.</li>
		<li>Add 500 &#956;l of prewarmed MEM + 5% FBS into each well. Return the 24-well plate to the CO2 incubator while preparing the bacterial cultures. 
		Note: To determine the exact CCL-23 cell number for multiplicity of infection (MOI), two wells can be trypsinized and counted on the day of infection.</li>
	</ol>
	</li>
</ol>
3. Adherence Assay
<ol>
	<li>Add pneumococci to the CCL-23 cells at a MOI ~10:1. Test the conditions listed in Table 1 in duplicate wells.
	<ol>
		<li>Measure the optical density at A600 (OD) of 1 ml of S. salivarius culture. OD should be between 0.3-0.6.</li>
		<li>Transfer 5 ml of S. salivarius culture into a 10 ml tube and centrifuge at 1,870 x g for 4 min.</li>
		<li>Discard the supernatant and based on the OD reading in section 3.1.1, resuspend S. salivarius in 200-1,000 &#956;l of 0.85% NaCl (final concentration ~1.5 x 109 CFU/ml). As a general guideline, an OD of 0.375 will be resuspended in 260 &#956;l. Prepare 1:10 and 1:100 dilutions of S. salivarius using 0.85% NaCl. 
		Note: In total, three concentrations (representing high, medium and low doses) of S. salivarius will be tested in the assay. The high dose is a ratio of ~10 S. salivarius : 1 pneumococci, the medium is ~1 S. salivarius : 1 pneumococci, and the low is ~1 S. salivarius : 10 pneumococci.</li>
		<li>Take out the 24-well plate from the incubator.</li>
		<li>From the heparin control wells, remove 40 &#956;l of media and add 50 &#956;l of heparin (1,000 U/ml stock concentration) for a final concentration of 100 U/ml.</li>
		<li>Add 10 &#956;l of 0.85% NaCl to wells containing CCL-23 cells only and wells containing CCL-23 cells and pneumococci (no S. salivarius).</li>
		<li>Add 10 ul of undiluted, 1:10 and 1:100 of S. salivarius to respective wells. 
		Note: S. salivarius can also be added at the same time as pneumococci (coaddition) or 1 hr after pneumococci (post-addition) to examine the effect of time of probiotic administration.</li>
		<li>Centrifuge the 24-well plate at 114 x g for 3 min to promote bacterial contact with the cell layer and incubate for 1 hr at 37&#176; C, 5% CO2 .</li>
		<li>Perform serial dilution of the S. salivarius stock in 0.85% NaCl and plate on duplicate HBA plates for viable counts. First, add 50 &#956;l of stock to 450 &#956;l of 0.85% NaCl to make a 10-1 dilution, then pulse vortex (5 sec), change tips, and add 50 &#956;l of the 10-1 dilution to 450 &#956;l of 0.85% NaCl to make a 10-2 dilution and so forth up to 10-7.</li>
		<li>Plate 100 &#956;l of the 10-5, 10-6, and 10-7 dilutions in duplicate on HBA plates and spread with a sterile spreader. Incubate HBA plates inverted overnight at 37 &#176;C, 5% CO2.</li>
		<li>Towards the end of the 1 hr incubation, repeat sections 3.1.1-3.1.3 for pneumococci. ODs should be between 0.2-0.7. Spin down 1 ml of pneumococcal culture and resuspend the pellet in 300-2,000 &#956;l of 0.85% NaCl (based on the OD reading) to a concentration of ~1.5 x 108 CFU/ml. As a general guideline, an OD of 0.3 will be resuspended in 500 &#956;l.</li>
		<li>After 1 hr incubation with S. salivarius, add 10 &#956;l undiluted pneumococci to all wells except negative control wells (containing cells only).</li>
		<li>Centrifuge the 24-well plate at 114 x g for 3 min and incubate at 37 &#176;C, 5% CO2 for 3 hr. Perform serial dilution of the pneumococci stock in 0.85% NaCl as described in section&#160;3.1.9 and plate dilutions 10-4, 10-5, and 10-6 on duplicate HBA plates for viable counts.</li>
	</ol>
	</li>
	<li>After 3 hr, check the cells under a microscope to ensure that monolayers look healthy (see Figure 2). Remove the media from each well and gently wash the cells 3x&#160;as described in section 2.2.3. using a different pipette for each condition. This step is essential to remove nonadherent pneumococci. The monolayers should not come apart during the washing process; this can be confirmed by checking again under a microscope.</li>
</ol>
Note: Media removed during this step can be stored at -20 &#176;C for additional analyses (e.g. measurement of cytokine levels).
<ol>
	<li>Add 200 &#956;l of 0.1% digitonin (a gentle detergent) to each well and incubate for 7 min at 37 &#176;C, 5% CO2.</li>
	<li>Add 800 &#956;l of THB media to each well. Lyse cells by pipetting up and down, and, if necessary, scrape wells 3-4x with the pipette tip to make sure the cell monolayer is completely removed. Change tips between wells.&#160;</li>
	<li>Remove the contents from each well using a P1000 pipette and transfer into labeled microfuge tubes.</li>
</ol>
4. Quantification of Adherent Pneumococci
Adherent pneumococci can be quantified by determining viable counts (serial dilution and plating on blood agar) or by quantitative real-time PCR.
<ol>
	<li>Viable count method 
	This method must be performed immediately after step 3.5 of the adherence assay.
	<ol>
		<li>For each assay well, prepare serial dilutions of samples collected in step 3.5 of the adherence assay by adding 50 &#956;l of samples to 450 &#956;l of 0.85% NaCl, pulse vortexing, and serially diluting as described in section 3.1.9 up to the 10-6 dilution.</li>
		<li>Plate 100 &#956;l of the 10-3, 10-4, 10-5, and 10-6 dilutions in duplicate on blood agar, spread with a sterile spreader, and incubate inverted plates overnight at 37 &#176;C, 5% CO2. Note that the wells containing CCL-23 cells alone should not contain any bacteria and can be plated neat (100 &#956;l undiluted) as a sterility control.</li>
		<li>The following day, determine the pneumococcal inocula by counting the colonies on the appropriate dilution plates (containing 30-300 colonies) prepared in section 3.1.13 of the adherence assay. Calculate the CFU/ml of the inocula using the averaged value from two plates. Similarly, determine the S. salivarius inocula by counting the colonies on the plates prepared in section 3.1.10. 
		Note: Plates should contain pneumococci only; the presence of other species indicates that the assay was contaminated and results are invalid.</li>
		<li>To determine the pneumococcal adherence levels, count the appropriate dilution plate (containing 30-300 pneumococcal colonies) for each sample prepared in section 4.1.1. Note that S. salivarius colonies will be small and white, whereas pneumococci will be flat and greenish due to &#945;-hemolysis, as shown in Figure 3. To calculate pneumococcal adherence, normalize the number of adherent pneumococci from condition b. CCL-23 cells + pneumococci to 100%, and compare adherent pneumococci from other conditions to this condition.</li>
	</ol>
	</li>
	<li>qPCR method 
	Samples collected in Adherence Assay step 3.5 can be stored at -20 &#176;C until DNA extraction. DNA extraction is performed using a commercial kit and described in sections 4.2.1-4.2.9 and the qPCR assay in sections 4.2.10-4.2.20.
	<ol>
		<li>Prepare Enzymatic Lysis Buffer (50 mM phosphate buffer pH 6.7 containing 1 mg/ml lysozyme, 0.075 mg/ml mutanolysin, and 2 mg/ml proteinase K). The following recipe can be used make 10 ml (enough for 50 extractions). Enzymatic lysis buffer should be freshly prepared prior to use. 
		 
		7.25 ml of 50 mM Phosphate Buffer solution (pH 6.7) 
		1.00 ml of 10 mg/ml lysozyme stock for a final [1 mg/ml] 
		0.75 ml of 1 mg/ml mutanolysin stock for a final [0.075 mg/ml] 
		1.00 ml of 20 mg/ml Proteinase K stock for a final [2 mg/ml] 
		&#160;</li>
		<li>Thaw the samples on ice or at 4 &#176;C. Vortex and transfer 100 &#956;l aliquots of each sample into labeled microfuge tubes. Return original samples back into the -20&#176;C freezer.</li>
		<li>Centrifuge the samples at 6,700 x g for 10 min.</li>
		<li>Remove and discard the supernatant. Add 200 &#956;l of enzymatic lysis buffer to the pellet and vortex to resuspend. Incubate the samples at 56 &#176;C for 30 min. Centrifuge briefly (5 sec) at 6,700 x g to collect liquid at the bottom of tube.</li>
		<li>Add 10 &#956;l of 20% SDS to complete the cell lysis and mix gently at room temperature for 2 min.</li>
		<li>Add 4 &#956;l of RNase A (100 mg/ml stock) and mix gently (on a rocker or by inverting the tubes) at room temperature for 2 min.</li>
		<li>Add 200 &#956;l of buffer AL (from kit) and vortex for 15 sec. Incubate samples at 70 &#176;C for 10 min. Centrifuge briefly (5 sec) at 6,700 x g to collect liquid at the bottom of tube.</li>
		<li>Add 200 &#956;l of 100% EtOH and vortex for 15 sec. Spin briefly to collect the liquid at bottom of tube, then transfer the mixture (including any precipitate) to the spin column (in a 2 ml collection tube) without wetting the rim. Follow wash steps according of the manufacturer&#8217;s protocol (not shown here).</li>
		<li>To elute DNA, transfer column into a labeled microfuge tube, add 50 &#956;l of Buffer AE (from kit), and incubate at room temperature for 2 min. Centrifuge at 4,300 x g for 1 min. Repeat once for a final elution volume of 100 &#956;l. DNA can be stored at -20 &#176;C until use.</li>
		<li>To perform qPCR, sterilize the hoods with UV light for 15 min prior to start. Preparing a 96-well plate map worksheet to record well locations for each sample is recommended.</li>
		<li>Prepare standard curve using a 10 ng/&#956;l stock of genomic pneumococcal DNA (extracted from reference strain ATCC 6305).
		<ol>
			<li>Thaw pneumococcal stock DNA and spin down briefly (5 sec) in a tabletop centrifuge.</li>
			<li>Perform 1:10 serial dilutions in 6 prelabeled microfuge tubes by adding 3 &#956;l DNA to 27 &#956;l nuclease-free H2O, changing tips and vortexing between each dilution. The final dilution series consists of 6 tubes: 1, 0.1, 0.01, 0.001, 0.0001, and 0.00001 ng/&#956;l. 
			Note: These can be stored at 4 &#176;C for up to one week.</li>
		</ol>
		</li>
		<li>Prepare lytA mastermix as follows in a sterile 15 ml conical tube in a sterile PCR hood. Thaw components on ice and vortex immediately prior to use.
		<table border="0">
			<tbody>
				<tr>
					<td>component</td>
					<td>per reaction </td>
					<td>x 102 (full plate)</td>
				</tr>
				<tr>
					<td>lytA F</td>
					<td>0.25 &#956;l of 10 &#956;M stock</td>
					<td>25.5 &#956;l</td>
				</tr>
				<tr>
					<td>lytA R</td>
					<td>0.25 &#956;l of 10 &#956;M stock</td>
					<td>25.5 &#956;l</td>
				</tr>
				<tr>
					<td>lytA probe</td>
					<td>0.5 &#956;l of 10 &#956;M stock</td>
					<td>51 &#956;l</td>
				</tr>
				<tr>
					<td>H2O</td>
					<td>9.5 &#956;l</td>
					<td>969 &#956;l</td>
				</tr>
				<tr>
					<td>Master mix</td>
					<td>12.5 &#956;l</td>
					<td>1,275 &#956;l</td>
				</tr>
				<tr>
					<td>Final volume</td>
					<td>23 &#956;l</td>
					<td>2,346 &#956;l</td>
				</tr>
			</tbody>
		</table>
		Note: Some real-time PCR machines require the use of a reference dye, which is contained in some commercial mastermixes or can be added separately. This protocol is designed for running 25 &#956;l reactions in a 96-well plate but can be adjusted to accommodate different real-time PCR machines. The primers and probe sequences were originally published by Carvalho et al.15 and are shown in the list of materials.</li>
		<li>Vortex and load 23 &#956;l/well of the lytA mix into the appropriate wells. Refer to plate map.</li>
		<li>Transport plate to template addition area (preferably a sterile cabinet in a separate room) for sample loading.</li>
		<li>Use a P2 pipette to load samples, changing tips for each well. All samples are run in duplicate. Refer to plate map for location.</li>
		<li>For standard curve wells, add 1 &#956;l/well of the appropriate dilution of standard curve DNA plus 1 &#956;l/well H2O to bring the final volume to 25 &#956;l. For no template control wells, add 2 &#956;l H2O.</li>
		<li>Add 2 &#956;l/well of sample DNA into appropriate wells.</li>
		<li>Cap all wells in use. Make sure caps are closed snugly. Quickly spin the PCR plate (5 sec) before loading the plate into a real-time PCR machine.</li>
		<li>Load plate into PCR machine and run qPCR according to the instructions provided by the machine manufacturer. The following hydrolysis probe cycling conditions are recommended:
		<table>
			<tbody>
				<tr>
					<td>Step 1 (1x):</td>
					<td>3 min at 95 &#176;C</td>
				</tr>
				<tr>
					<td>Step 2 (40x):</td>
					<td>20 sec at 95 &#176;C</td>
				</tr>
				<tr>
					<td></td>
					<td>20 sec at 60 &#176;C</td>
				</tr>
			</tbody>
		</table>
		</li>
		<li>Collect data and quantify pneumococcal DNA using the standard curve. Bacterial loads are calculated as previously described17, estimating that 1 pg of genomic DNA is equivalent to 447.4 cells, and reported as CFU/ml (assuming one genome per CFU, and one copy of lytA per genome; see Figure 4). For a successful assay, the R2 value should be &#8805;0.98 and all positive results within the range of the standard curve (cT values less than that obtained for the 0.00001 ng/&#956;l standard curve point are considered background/lytA negative). 
		Note: Some real-time PCR systems come with analysis software that can be used to construct standard curves and calculate unknowns. Otherwise, these calculations can be performed in Excel or similar programs. An example standard curve is shown in Figure 4.</li>
		<li>To calculate pneumococcal adherence, normalize the number of adherent pneumococci from condition b. CCL-23 cells + pneumococci to 100%, and compare adherent pneumococci from other conditions to this condition.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>O'Brien, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burden+of+disease+caused+by+Streptococcus+pneumoniae+in+children+younger+than+5+years:+global+estimates.">Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates.</a> Lancet. 374, 893-902 (2009).</li><li>Bogaert, D., de Groot, R., Hermans, P. W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptococcus+pneumoniae+colonisation:+the+key+to+pneumococcal+disease.">Streptococcus pneumoniae colonisation: the key to pneumococcal disease.</a> Lancet Infect. Dis. 4 (04), 144-154 (2004).</li><li>Weinberger, D. M., Malley, R., Lipsitch, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype+replacement+in+disease+after+pneumococcal+vaccination.">Serotype replacement in disease after pneumococcal vaccination.</a> Lancet. 378 (10), 1962-1973 (2011).</li><li>Jacoby, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modelling+the+co-occurrence+of+Streptococcus+pneumoniae+with+other+bacterial+and+viral+pathogens+in+the+upper+respiratory+tract.">Modelling the co-occurrence of Streptococcus pneumoniae with other bacterial and viral pathogens in the upper respiratory tract.</a> Vaccine. 25, 2458-2464 (2007).</li><li>Kwambana, B., Barer, M., Bottomley, C., Adegbola, R., Antonio, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+acquisition+and+high+nasopharyngeal+co-colonisation+by+Streptococcus+pneumoniae+and+three+respiratory+pathogens+amongst+Gambian+new-borns+and+infants.">Early acquisition and high nasopharyngeal co-colonisation by Streptococcus pneumoniae and three respiratory pathogens amongst Gambian new-borns and infants.</a> BMC Infect. Dis. 11, (2011).</li><li>Licciardi, P. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protecting+against+pneumococcal+disease:+critical+interactions+between+probiotics+and+the+airway+microbiome.">Protecting against pneumococcal disease: critical interactions between probiotics and the airway microbiome.</a> PLoS Pathog. 8, (2012).</li><li>Popova, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beneficial+effects+of+probiotics+in+upper+respiratory+tract+infections+and+their+mechanical+actions+to+antagonize+pathogens.">Beneficial effects of probiotics in upper respiratory tract infections and their mechanical actions to antagonize pathogens.</a> J. Appl. Microbiol. 113 (6), 1305-1318 (2012).</li><li>Pracht, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PavA+of+Streptococcus+pneumoniae+modulates+adherence,+invasion,+and+meningeal+inflammation.">PavA of Streptococcus pneumoniae modulates adherence, invasion, and meningeal inflammation.</a> Infect. Immun. 73, 2680-2689 (2005).</li><li>Adamou, J. E., Wizemann, T. M., Barren, P., Langermann, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adherence+of+Streptococcus+pneumoniae+to+human+bronchial+epithelial+cells+(BEAS-2B).">Adherence of Streptococcus pneumoniae to human bronchial epithelial cells (BEAS-2B).</a> Infect. Immun. 66, 820-822 (1998).</li><li>Wong, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Streptococcus+pneumoniae+adherence+to+human+epithelial+cells+in+vitro+by+the+probiotic+Lactobacillus+rhamnosus+GG.">Inhibition of Streptococcus pneumoniae adherence to human epithelial cells in vitro by the probiotic Lactobacillus rhamnosus GG.</a> BMC Res. Notes. 6 (1), 135 (2013).</li><li>Wescombe, P. A., Heng, N. C. K., Burton, J. P., Chilcott, C. N., Tagg, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptococcal+bacteriocins+and+the+case+for+Streptococcus+salivarius+as+model+oral+probiotics.">Streptococcal bacteriocins and the case for Streptococcus salivarius as model oral probiotics.</a> Future Microbiol. 4, 819-835 (2009).</li><li>Di Pierro, F., Adami, T., Rapacioli, G., Giardini, N., Streitberger, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+evaluation+of+the+oral+probiotic+Streptococcus+salivarius+K12+in+the+prevention+of+recurrent+pharyngitis+and/or+tonsillitis+caused+by+Streptococcus+pyogenes+in+adults.">Clinical evaluation of the oral probiotic Streptococcus salivarius K12 in the prevention of recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes in adults.</a> Expert. Opin. Biol. Ther. 13 (3), 339-343 (2013).</li><li>Fiedler, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+mechanisms+of+respiratory+tract+streptococci+against+Streptococcus+pyogenes+biofilm+formation+and+epithelial+cell+infection.">Protective mechanisms of respiratory tract streptococci against Streptococcus pyogenes biofilm formation and epithelial cell infection.</a> Appl. Environ. Microbiol. 79, 1265-1276 (2013).</li><li>Slotved, H. C., Satzke, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+growth+of+pneumococcal+isolates+representing+23+different+serotypes.">In vitro growth of pneumococcal isolates representing 23 different serotypes.</a> BMC Res. Notes. 6, 10-1186 (2013).</li><li>Carvalho, M. d. G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+and+improvement+of+real-time+PCR+assays+targeting+lytA,+ply,+and+psaA+genes+for+detection+of+pneumococcal+DNA.">Evaluation and improvement of real-time PCR assays targeting lytA, ply, and psaA genes for detection of pneumococcal DNA.</a> J. Clin. Microbiol. 45, 2460-2466 (2007).</li><li>Tonnaer, E. L. G. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+glycosaminoglycans+in+the+attachment+of+pneumococci+to+nasopharyngeal+epithelial+cells.">Involvement of glycosaminoglycans in the attachment of pneumococci to nasopharyngeal epithelial cells.</a> Microbes Infect. 8, 316-322 (2006).</li><li>Smith-Vaughan, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+nasal+bacterial+load+and+its+association+with+otitis+media.">Measuring nasal bacterial load and its association with otitis media.</a> BMC Ear Nose Throat Disord. 6, (2006).</li><li>Letourneau, J., Levesque, C., Berthiaume, F., Jacques, M., Mourez, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+assay+of+bacterial+adhesion+onto+mammalian+epithelial+cells.">In vitro assay of bacterial adhesion onto mammalian epithelial cells.</a> J. Vis. Exp. , (2011).</li></ol>

The authors have nothing to disclose.

A critical portion of this assay is adding the appropriate concentrations of S. salivarius and pneumococci in sections 3.1.7 and 3.1.12. Concentrations are estimated using OD readings but the exact inocula are not determined until plates are counted the following day. For this reason, we recommend performing growth curves to measure OD and viable counts (CFU/ml) over time for all bacterial strains used in the assay to identify the mid-log phase and assist in estimating concentration by OD. Additionally, pneumoco...

Streptococcus pneumoniae (the pneumococcus) is a Gram positive bacterium that can cause infections including pneumonia, otitis media, and meningitis. It is a major cause of disease in children in low-income countries and responsible for an estimated 800,000 deaths of children under the age of five annually1. Pneumococci are frequently carried in the nasopharynx of young children. Although this colonization is generally considered asymptomatic, it precedes pneumococcal infection and serves as a reservoir for the bacteria in human populations2. Pneumococcal conjugate vaccination effectively reduces carriage of the serotypes contained within the vaccine. However, there are over 90 pneumococcal serotypes, and vaccination can lead to serotype replacement, whereby the elimination of vaccine serotypes is followed by a rise in carriage and disease caused by nonvaccine serotypes3. Also, in some high-risk populations, pneumococcal colonization often occurs very early in life, prior to administration of the first vaccine dose4,5. Recently, the use of probiotics has been proposed as an additional strategy to inhibit pneumococcal colonization6,7. In vitro adherence assays have been used to examine pneumococcal adherence8,9. These assays have been adapted to investigate the impact of the probiotic Lactobacillus rhamnosus GG (LGG) on pneumococcal adherence10.
In addition to LGG and other lactic acid bacteria, Streptococcus salivarius, a common resident of the oral cavity, has been investigated as a potential probiotic for the respiratory tract due to its colonization potential and ability to inhibit pneumococci and other respiratory pathogens in vitro11-13. The protocol presented here describes an adherence assay used to investigate the effects of S. salivarius K12 on pneumococcal adherence to the human epithelial cell line CCL-23. Prior to use in the assay, pneumococcal isolates were evaluated for adherence capabilities, as growth and adherence properties can vary substantially among isolates10,14. Growth curves of pneumococci and S. salivarius were performed to determine mid-log phase and estimate concentration (colony forming units or CFU/ml) by optical density (OD, Figure 1).&#160;It is recommended to examine growth by viable count and OD for each isolate prior to use in the assay. This assay can be performed in any laboratory with standard tissue culture facilities and equipment. In this protocol, the effects of three doses of S. salivarius administered 1 hr prior to the addition of pneumococci on the adherence of S. pneumoniae PMP843, a serotype 19F carriage isolate derived from a nasopharyngeal swab, are examined. Two different ways to quantify adherent pneumococci are presented: plating on blood agar to determine viable counts, and DNA extraction and detection of the pneumococcal lytA gene by qPCR15. The basic adherence assay protocol can be easily modified to test different doses or time of administration of probiotics and can also be used with other bacterial strains or species.

<table border="0" cellpadding="0" cellspacing="0" width="1318">
	<colgroup>
		<col />
		<col />
		<col />
		<col span="2" />
	</colgroup>
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Minimum Essential Media (MEM)</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">SH30244.01</td>
			<td style="width:377px;"> </td>
			<td style="width:377px;"> </td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Fetal Bovine Serum (FBS)</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td>SH30084.03</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">T-75 Flask</td>
			<td style="width:155px;">Nunc</td>
			<td>156472</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">CCL-23 cells</td>
			<td style="width:155px;">ATCC</td>
			<td style="width:147px;">CCL-23</td>
			<td style="width:377px;"> </td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Trypsin</td>
			<td>Life Technologies</td>
			<td>15090046</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:264px;">24-well cell culture plate</td>
			<td style="width:155px;">Nunc</td>
			<td style="width:147px;">142475</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Horse blood agar (HBA) plates</td>
			<td style="width:155px;">Oxoid</td>
			<td style="width:147px;">PP2001</td>
			<td>Sheep blood agar plates also acceptable</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Todd-Hewitt Broth</td>
			<td style="width:155px;">Oxoid</td>
			<td style="width:147px;">CM0189</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Yeast Extract</td>
			<td style="width:155px;">Beckton Dickinson</td>
			<td style="width:147px;">212750</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Digitonin</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:147px;">D141-100MG</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Disposable cuvettes</td>
			<td style="width:155px;">Kartell</td>
			<td>1938</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Heparin</td>
			<td style="width:155px;">Pfizer</td>
			<td style="width:147px;">2112105</td>
			<td>comes in sterile ampules at 5,000IU/5mL </td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">sterile spreader</td>
			<td style="width:155px;">Technoplas</td>
			<td style="width:147px;">S10805050</td>
			<td style="width:377px;">alternatively, a glass spreader can be dipped in 96% ethanol and flame sterilized before each use</td>
			<td style="width:377px;"> </td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Lysozyme</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">L6876</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Mutanolysin</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">M9901</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Proteinase K</td>
			<td>Qiagen</td>
			<td>19133</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">SDS 20% solution</td>
			<td>Ambion </td>
			<td style="width:147px;">AM9820</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">RNase A</td>
			<td>Qiagen</td>
			<td style="width:147px;">19101</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">QIAamp DNA mini-kit (250)</td>
			<td>Qiagen</td>
			<td style="width:147px;">51306</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA F primer</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">Custom made</td>
			<td>5&#39; -&#62; 3&#39; sequence ACGCAATCTAGCAGATGAAGCA</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA R primer</td>
			<td>Sigma-Aldrich</td>
			<td style="width:147px;">Custom made</td>
			<td>5&#39; -&#62; 3&#39; sequence TCGTGCGTTTTAATTCCAGCT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">LytA probe</td>
			<td>Eurogentec</td>
			<td style="width:147px;">Custom made</td>
			<td colspan="2">5&#39; -&#62; 3&#39; sequence Cy5-TGCCGAAAACGCTTGATACAGGGAG-BHQ3, alternative fluorophores can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Nuclease free water</td>
			<td>Ambion</td>
			<td style="width:147px;">AM9906</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Brilliant III Ultra Fast QPCR mastermix</td>
			<td>Agilent Technologies </td>
			<td style="width:147px;">600880</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Thermo-Fast 96 Detection plate </td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">AB-1100</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:264px;">Ultra clear qPCR cap strips</td>
			<td style="width:155px;">Thermo Fisher Scientific</td>
			<td style="width:147px;">AB-0866</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;">Mx3005 QPCR System</td>
			<td style="width:155px;">Agilent Technologies </td>
			<td style="width:147px;">401449</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:264px;"> </td>
			<td style="width:155px;"> </td>
			<td style="width:147px;"> </td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">* alternative sources are available for most/all products listed</td>
			<td style="width:147px;"> </td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

investigating the effects of probiotics on pneumococcal colonization using an in vitro adherence assay

Adherence of Streptococcus pneumoniae (the pneumococcus) to the epithelial lining of the nasopharynx can result in colonization and is considered a prerequisite for pneumococcal infections such as pneumonia and otitis media. In vitro adherence assays can be used to study the attachment of pneumococci to epithelial cell monolayers and to investigate potential interventions, such as the use of probiotics, to inhibit pneumococcal&#160;colonization.&#160;The protocol described here is used to investigate the effects of the probiotic Streptococcus salivarius on the adherence of pneumococci to the human epithelial cell line CCL-23 (sometimes referred to as HEp-2 cells). The assay involves three main steps: 1) preparation of epithelial and bacterial cells, 2) addition of bacteria to epithelial cell monolayers, and 3) detection of adherent pneumococci by viable counts (serial dilution and plating) or quantitative real-time PCR (qPCR). This technique is relatively straightforward and does not require specialized equipment other than a tissue culture setup. The assay can be used to test other probiotic species and/or potential inhibitors of pneumococcal colonization and can be easily modified to address other scientific questions regarding pneumococcal adherence and invasion.

Results from a representative experiment in which pneumococci (S. pneumoniae PMP843, a colonizing 19F isolate) were added to CCL-23 cells 1 hr after the addition of S. salivarius, and pneumococcal adherence was quantified by both viable count and lytA qPCR are shown in Table 2. Results were consistent between the two methods for both the absolute number of bacteria (presented as CFU/ml) and the % adherence, normalized to the number of adherent pneumococci in the wells containin...

Watch this Scientific Journal Video about Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay at JoVE.com

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

In vitro adherence assays can be used to study the attachment of Streptococcus pneumoniae to epithelial cell monolayers and to investigate potential interventions such as the use of probiotics for inhibiting pneumococcal colonization.

Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

Adherence of Streptococcus pneumoniae (the pneumococcus) to the epithelial lining of the nasopharynx can result in colonization and is considered a ...

investigating-effects-probiotics-on-pneumococcal-colonization-using

Research

JoVE Journal

Immunology and Infection

12.5K vistas.  Murdoch Childrens Research Institute.  En ensayos in vitro de adherencia se pueden utilizar para estudiar la unión de Streptococcus pneumoniae a monocapas de células epiteliales y para investigar las posibles intervenciones, tales como el uso de los probióticos para la inhibición de la colonización neumocócica. 

Video: Investigating the Effects of Probiotics on Pneumococcal Colonization Using an In Vitro Adherence Assay

In vitro Biofilm Formation in an 8-well Chamber Slide

The chronic nature of many diseases is attributed to the formation of bacterial biofilms which are recalcitrant to traditional antibiotic therapy. Biofilms are community-associated bacteria attached to a surface and encased in a matrix. The role of the extracellular matrix is multifaceted, including facilitating nutrient acquisition, and offers significant protection against environmental stresses (e.g. host immune responses). In an effort to acquire a better understanding as to how the bacteria within a biofilm respond to environmental stresses we have used a protocol wherein we visualize bacterial biofilms which have formed in an 8-well chamber slide. The biofilms were stained with the BacLight Live/Dead stain and examined using a confocal microscope to characterize the relative biofilm size, and structure under varying incubation conditions. Z-stack images were collected via confocal microscopy and analyzed by COMSTAT. This protocol can be used to help elucidate the mechanism and kinetics by which biofilms form, as well as identify components that are important to biofilm structure and stability.

In vitro Biofilm Formation in an 8-well Chamber Slide

This article describes the procedure for the formation and visualization of a bacterial biofilm grown within an 8-well chamber slide

The chronic nature of many diseases is attributed to the formation of bacterial biofilms which are recalcitrant to traditional antibiotic therapy. ...

A Microplate Assay to Assess Chemical Effects on RBL-2H3 Mast Cell Degranulation: Effects of Triclosan without Use of an Organic Solvent

Mast cells play important roles in allergic disease and immune defense against parasites. Once activated (e.g. by an allergen), they degranulate, a process that results in the exocytosis of allergic mediators. Modulation of mast cell degranulation by drugs and toxicants may have positive or adverse effects on human health. Mast cell function has been dissected in detail with the use of rat basophilic leukemia mast cells (RBL-2H3), a widely accepted model of human mucosal mast cells3-5. Mast cell granule component and the allergic mediator &#946;-hexosaminidase, which is released linearly in tandem with histamine from mast cells6, can easily and reliably be measured through reaction with a fluorogenic substrate, yielding measurable fluorescence intensity in a microplate assay that is amenable to high-throughput studies1. Originally published by Naal et al.1, we have adapted this degranulation assay for the screening of drugs and toxicants and demonstrate its use here.
Triclosan is a broad-spectrum antibacterial agent that is present in many consumer products and has been found to be a therapeutic aid in human allergic skin disease7-11, although the mechanism for this effect is unknown. Here we demonstrate an assay for the effect of triclosan on mast cell degranulation. We recently showed that triclosan strongly affects mast cell function2. In an effort to avoid use of an organic solvent, triclosan is dissolved directly into aqueous buffer with heat and stirring, and resultant concentration is confirmed using UV-Vis spectrophotometry (using &#949;280 = 4,200 L/M/cm)12. This protocol has the potential to be used with a variety of chemicals to determine their effects on mast cell degranulation, and more broadly, their allergic potential.

Mast cell degranulation, the release of allergic mediators, is important in allergy, asthma, and parasite defense. Here we demonstrate techniques1 for assessing effects of drugs and toxicants on degranulation, methodology recently utilized to exhibit the powerful inhibitory effect of antibacterial agent triclosan2.

Mast cells play important roles in allergic disease and immune defense against parasites. Once activated (e.g. by an allergen), they degranulate, a ...

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are upregulated upon this ongoing antigen exposure and contribute to loss of proliferation, reduced cytolytic function, and impaired cytokine production by CD4 and CD8 T cells. In the murine model of LCMV infection, administration of blocking antibodies against these two pathways augmented T cell responses. However, there is currently no in vitro assay to measure the impact of such blockade on cytokine secretion in cells from human samples. Our protocol and experimental approach enable us to accurately and efficiently quantify the restoration of cytokine production by HIV-specific CD4 T cells from HIV infected subjects.
Here, we depict an in vitro experimental design that enables measurements of cytokine secretion by HIV-specific CD4 T cells and their impact on other cell subsets. CD8 T cells were depleted from whole blood and remaining PBMCs were isolated via Ficoll separation method. CD8-depleted PBMCs were then incubated with blocking antibodies against PD-L1 and/or IL-10R&#945; and, after stimulation with an HIV-1 Gag peptide pool, cells were incubated at 37 &#176;C, 5% CO2. After 48 hr, supernatant was collected for cytokine analysis by beads arrays and cell pellets were collected for either phenotypic analysis using flow cytometry or transcriptional analysis using qRT-PCR. For more detailed analysis, different cell populations were obtained by selective subset depletion from PBMCs or by sorting using flow cytometry before being assessed in the same assays. These methods provide a highly sensitive and specific approach to determine the modulation of cytokine production by antigen-specific T-helper cells and to determine functional interactions between different populations of immune cells.

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

We developed an in vitro assay to investigate the role of immunoregulatory pathways in the regulation of cytokine secretion by HIV-specific CD4 T cells.

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. Despite advances in knowledge of this illness, the availability of intensive care units (ICU), and the use of potent antimicrobial agents and effective vaccines, the mortality rates remain high1. Streptococcus pneumoniae is the leading pathogen of community-acquired pneumonia (CAP) and one of the most common causes of bacteremia in humans. This pathogen is equipped with an armamentarium of surface-exposed adhesins and virulence factors contributing to pneumonia and invasive pneumococcal disease (IPD). The assessment of the in vivo role of bacterial fitness or virulence factors is of utmost importance to unravel S. pneumoniae pathogenicity mechanisms. Murine models of pneumonia, bacteremia, and meningitis are being used to determine the impact of pneumococcal factors at different stages of the infection. Here we describe a protocol to monitor in real-time pneumococcal dissemination in mice after intranasal or intraperitoneal infections with bioluminescent bacteria. The results show the multiplication and dissemination of pneumococci in the lower respiratory tract and blood, which can be visualized and evaluated using an imaging system and the accompanying analysis software.

Streptococcus pneumoniae is the leading pathogen causing severe community-acquired pneumonia and responsible for over 2&#160;million deaths worldwide. The impact of bacterial factors implicated in fitness or virulence can be monitored in real-time in an acute mouse pneumonia or bacteremia model using bioluminescent bacteria.

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal epidemiology, capsular serotyping can provide useful information for vaccine efficacy and impact studies.&#160;The Quellung reaction is the gold standard method for pneumococcal capsular serotyping. The method involves testing a pneumococcal cell suspension with pooled and specific antisera directed against the capsular polysaccharide. The antigen-antibody reactions are observed microscopically. The protocol has three main steps: 1) preparation of a bacterial cell suspension, 2) mixing of cells and antisera on a glass slide, and 3) reading the Quellung reaction using a microscope. The Quellung reaction is reasonably simple to perform and can be applied wherever a suitable microscope and antisera are available.

Capsular Serotyping of Streptococcus pneumoniae Using the Quellung Reaction

The Quellung reaction is the gold standard technique for serotyping Streptococcus pneumoniae. This technique utilizes a microscope and specific pneumococcal antisera and is commonly used in reference and research laboratories worldwide.

There are over 90 different capsular serotypes of Streptococcus pneumoniae (the pneumococcus). As well as being a tool for understanding pneumococcal ...

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major cause of morbidity and mortality world-wide. Current vaccines target the pneumococcal capsule, and there are over 90 capsular serotypes. Serotyping pneumococcal isolates is therefore important for assessing the impact of vaccination programs and for epidemiological purposes. The World Health Organization has recommended latex agglutination as an alternative method to the &#8216;gold standard&#8217; Quellung test for serotyping pneumococci. Latex agglutination is a relatively simple, quick and inexpensive method; and is therefore suitable for resource-poor settings as well as laboratories with high-volume workloads. Latex agglutination reagents can be prepared in-house utilizing commercially-sourced antibodies that are passively attached to latex particles. This manuscript describes a method of production and quality control of latex agglutination reagents, and details a sequential testing approach which is time- and cost-effective. 
This method of production and quality control may also be suitable for other testing purposes.

Capsular Serotyping of Streptococcus pneumoniae by Latex Agglutination

Latex agglutination testing is a simple, rapid and inexpensive method for serotyping Streptococcus pneumoniae, and has also been widely applied in diagnostic microbiology. This manuscript describes the in-house production of latex agglutination reagents, quality control procedures and the application of this technique to pneumococcal serotyping.

Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major ...

Using the Overlay Assay to Qualitatively Measure Bacterial Production of and Sensitivity to Pneumococcal Bacteriocins

Streptococcus pneumoniae colonizes the highly diverse polymicrobial community of the nasopharynx where it must compete with resident organisms. We have shown that bacterially produced antimicrobial peptides (bacteriocins) dictate the outcome of these competitive interactions. All fully-sequenced pneumococcal strains harbor a bacteriocin-like peptide (blp) locus. The blp locus encodes for a range of diverse bacteriocins and all of the highly conserved components needed for their regulation, processing, and secretion. The diversity of the bacteriocins found in the bacteriocin immunity region (BIR) of the locus is a major contributor of pneumococcal competition. Along with the bacteriocins, immunity genes are found in the BIR and are needed to protect the producer cell from the effects of its own bacteriocin. The overlay assay is a quick method for examining a large number of strains for competitive interactions mediated by bacteriocins. The overlay assay also allows for the characterization of bacteriocin-specific immunity, and detection of secreted quorum sensing peptides. The assay is performed by pre-inoculating an agar plate with a strain to be tested for bacteriocin production followed by application of a soft agar overlay containing a strain to be tested for bacteriocin sensitivity. A zone of clearance surrounding the stab indicates that the overlay strain is sensitive to the bacteriocins produced by the pre-inoculated strain. If no zone of clearance is observed, either the overlay strain is immune to the bacteriocins being produced or the pre-inoculated strain does not produce bacteriocins. To determine if the blp locus is functional in a given strain, the overlay assay can be adapted to evaluate for peptide pheromone secretion by the pre-inoculated strain. In this case, a series of four lacZ-reporter strains with different pheromone specificity are used in the overlay.

Competition in Streptococcus pneumoniae is mediated by bacteriocins, small antimicrobial peptides with inhibitory activity towards pneumococcus and other related species.&#160; Here we describe an optimized bacterial overlay assay that allows for the characterization of bacteriocin activity and inhibitory spectrum, bacteriocin-specific immunity, and detection of secreted quorum sensing peptides.

Streptococcus pneumoniae colonizes the highly diverse polymicrobial community of the nasopharynx where it must compete with resident organisms.  We have ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal model experimental autoimmune encephalomyelitis (EAE). This process is characterized by the transmigration of activated T cells across brain endothelial cells (ECs), the main constituents of the BBB. However, the consequences on brain EC function upon interaction with such T cells are largely unknown. Here we describe an assay that allows for the evaluation of primary mouse brain microvascular EC (MBMEC) function and barrier integrity during the interaction with T cells over time. The assay makes use of impedance cell spectroscopy, a powerful tool for studying EC monolayer integrity and permeability, by measuring changes in transendothelial electrical resistance (TEER) and cell layer capacitance (Ccl). In direct contact with ECs, stimulated but not na&#239;ve T cells are capable of inducing EC monolayer dysfunction, as visualized by a decrease in TEER and an increase in Ccl. The assay records changes in EC monolayer integrity in a continuous and automated fashion. It is sensitive enough to distinguish between different strengths of stimuli and levels of T cell activation and it enables the investigation of the consequences of a targeted modulation of T cell-EC interaction using a wide range of substances such as antibodies, pharmacological reagents and cytokines. The technique can also be used as a quality control for EC integrity in in vitro T-cell transmigration assays. These applications make it a versatile tool for studying BBB properties under physiological and pathophysiological conditions.

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Here, we describe an in vitro murine model of the blood-brain barrier that makes use of impedance cell spectroscopy, with a focus on the consequences on endothelial cell integrity and permeability upon interaction with activated T cells.

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...

Flow Cytometric Analysis of Particle-bound Bet v 1 Allergen in PM10

Flow cytometry is a method widely used to quantify suspended solids such as cells or bacteria in a size range from 0.5 to several tens of micrometers in diameter. In addition to a characterization of forward and sideward scatter properties, it enables the use of fluorescent labeled markers like antibodies to detect respective structures. Using indirect antibody staining, flow cytometry is employed here to quantify birch pollen allergen (precisely Bet v 1)-loaded particles of 0.5 to 10 &#181;m in diameter in inhalable particulate matter (PM10, particle size &#8804;10 &#181;m in diameter). PM10 particles may act as carriers of adsorbed allergens possibly transporting them to the lower respiratory tract, where they could trigger allergic reactions.
So far the allergen content of PM10 has been studied by means of enzyme linked immunosorbent assays (ELISAs) and scanning electron microscopy. ELISA measures the dissolved and not the particle-bound allergen. Compared to scanning electron microscopy, which can visualize allergen-loaded particles, flow cytometry may additionally quantify them. As allergen content of ambient air can deviate from birch pollen count, allergic symptoms might perhaps correlate better with allergen exposure than with pollen count. In conjunction with clinical data, the presented method offers the opportunity to test in future experiments whether allergic reactions to birch pollen antigens are associated with the Bet v 1 allergen content of PM10 particles &#62;0.5 &#181;m.

Here, we present a protocol to quantify allergen-loaded particles by flow cytometry. Ambient particulate matter particles may act as carriers of adsorbed allergens. We show here that flow cytometry, a method widely used to characterize suspended solids &#62;0.5 &#181;m in diameter, can be used to measure these allergen-loaded particles.

Flow cytometry is a method widely used to quantify suspended solids such as cells or bacteria in a size range from 0.5 to several tens of micrometers in ...

Visualizing the Effects of Sputum on Biofilm Development Using a Chambered Coverglass Model

Biofilms consist of groups of bacteria encased in a self-secreted matrix. They play an important role in industrial contamination as well as in the development and persistence of many health related infections. One of the most well described and studied biofilms in human disease occurs in chronic pulmonary infection of cystic fibrosis patients. When studying biofilms in the context of the host, many factors can impact biofilm formation and development. In order to identify how host factors may affect biofilm formation and development, we used a static chambered coverglass method to grow biofilms in the presence of host-derived factors in the form of sputum supernatants. Bacteria are seeded into chambers and exposed to sputum filtrates. Following 48 hr of growth, biofilms are stained with a commercial biofilm viability kit prior to confocal microscopy and analysis. Following image acquisition, biofilm properties can be assessed using different software platforms. This method allows us to visualize key properties of biofilm growth in presence of different substances including antibiotics.

This protocol describes the visualization of biofilm development following exposure to host-factors using a slide chamber model. This model allows for direct visualization of biofilm development as well as analysis of biofilm parameters using computer software programs.

Biofilms consist of groups of bacteria encased in a self-secreted matrix. They play an important role in industrial contamination as well as in the ...