behavior

JoVE Behavior documents observational and experimental techniques that seek to understand human and animal behavior. Work in this field includes analysis of genetic causes and physiological responses to internal or external stimuli as well as the implicated brain regions.

Sciences du comportement

biochemistry

JoVE Biochemistry publishes experiments that investigate the structure, function, and interactions of biological molecules. The video articles in this section demonstrate methods to study nucleic acids, proteins, carbohydrates and lipids as well as enzyme function, protein folding, molecular interactions and biochemical reactions.

Biochimie

bioengineering

JoVE Bioengineering merges both physical and life sciences to understand and predict biological processes. Applying physical science tools to life science questions allow for the discovery of better technologies to measure, diagnose, and clinically treat disease.

Bio-ingénierie

biology

JoVE Biology welcomes all general biology research methodologies. Content in this section canvases all fields of cell, molecular, and organismal biology, ranging from new applications of standard techniques to novel approaches aimed at understanding the functions of life and living organisms. This diverse section includes, but is not limited to, techniques in physical biology, cellular biochemistry, genetics, physiology, systems biology and a combination of eukaryotic and prokaryotic model systems.

Biologie

cancer research

JoVE Cancer Research illustrates experimental approaches in biomedical research and clinical practice aimed at understanding, detecting, treating and preventing cancer. The video articles in this section demonstrate methods to study the cellular and molecular mechanisms of cancer, animal models of cancer research, development of new therapies and diagnostics, tumor imaging, chemical and radiation treatments, surgical procedures and improvements in therapy. These video articles offer researchers and clinical practitioners an efficient way to learn the technologies and experimental methods in cancer research.

Recherche en cancérologie

chemistry

JoVE Chemistry surveys a broad scope of chemical disciplines. This collection includes fundamental and applied research that investigates molecular interactions, properties, and structure spanning in the following core divisions: analytical, organic, organometallic, inorganic, bioinorganic, and biochemistry. This section also includes the design and preparation of materials and small molecules for advanced or unique applications.

Chimie

developmental biology

JoVE Developmental Biology publishes research methodologies in the field of developmental biology. This includes methods that are used to study biological development in vitro and in vivo at the molecular, cellular, tissue, organ and whole organism levels.

Biologie du développement

engineering

JoVE Engineering encompasses a broad range of experimental and instrumental techniques utilized in physics research. Investigations in this area strive to address and answer a broad range of scientific questions, such as device mechanisms and efficiencies, using physical tools. This approach often requires a combination of specialties, and research in this area tends to be interdisciplinary with contributions from mechanical, electrical, and chemical engineers.

Ingénierie

environment

JoVE Environment is dedicated to research methodologies that address environmental concerns and seek to better understand Earth's ecosystem.  Special consideration is given to experimental methodologies that assess society’s impact on the environment, suggest solutions for protecting Earth’s resources, and develop sustainable fuel sources. Moving towards an environmentally conscious planet is a collaborative effort with contributions from both life and physical scientists.

Environnement

genetics

JoVE Genetics publishes video articles demonstrating experimental approaches to investigate gene function and regulation. This includes methods to study gene expression, mutagenesis, epigenetics, genetic determinants of development, genetic disorders, population genetics and evolution.

Génétique

immunology and infection

JoVE Immunology and Infection includes content from a variety of fields working toward a shared initiative of improving global health. Techniques evaluating the biological response to pathogens from the molecular to organismal level are presented as well as therapeutic agents and their efficacy in treating disease.

Immunologie et infection

medicine

JoVE Medicine serves as a connection between basic research and clinical applications. Articles may present medical procedures, case studies or clinical trial methodologies. Included studies are often modeled towards predictive, preventative, personalized, and practical approaches to treatment of disease. The goal of research methodologies in this section is to improve overall patient care and prognosis.

Médecine

neuroscience

JoVE Neuroscience is a multidisciplinary section devoted to investigations of the structure, function, physiology, and pathophysiology of the brain and nervous system. Included methodologies range from molecular and cellular level studies to full central and peripheral neural systems. Potential treatment platforms and surgical techniques for neurological diseases and disorders are also presented in this section.

Neurosciences

jove journal

JoVE Journal

Journal vidéo scientifique. Evaluation par les pairs. Multi-disciplinaire. Indexé dans Pubmed et Web of Science.

https://cloudfront.jove.com/files/banners/journal/journal_lander.jpg

Research

2D NMR: Overview of Heteronuclear Correlation Techniques

Heteronuclear correlation spectroscopy is an analytical technique that investigates the coupling between different types of nuclei, often a proton and an X-nucleus, such as carbon-13 or nitrogen-15. This method is commonly used in nuclear magnetic resonance (NMR) spectroscopy to gain insights into complex chemical compounds&#39; structural and compositional aspects. A typical heteronuclear correlation spectrum displays X-nucleus chemical shifts on one axis and a proton spectrum on the other axis. Cross-peaks reveal the connection between specific protons and X-nuclei.
The main heteronuclear correlation experiments include HETCOR, HSQC, HMQC, and HMBC. HSQC, HMQC, and HMBC record the proton spectrum, whereas the X-nucleus spectrum is recorded by standard heteronuclear correlation spectroscopy or HETCOR. The HETCOR-HMQC-HSQC group of experiments cannot detect X-nuclei without an attached proton. HETCOR is used when ultrahigh peak resolution is required along the X-nucleus axis.
The heteronuclear single quantum correlation technique, or HSQC, investigates proton-to-X-nucleus single bond correlations. In an HSQC experiment, polarization is transferred from a proton nucleus to a neighboring X-nucleus and then back to the proton nucleus. The signal from the proton nuclei is then recorded. HSQC generates a spectrum like that of heteronuclear multiple-quantum correlation spectroscopy or HMQC but uses a different suppression method, providing better X-nucleus resolution along the axis.
Heteronuclear multiple-bond correlation, or HMBC, is a proton-detected experiment, like HMQC but with a longer initial delay time. This experiment is used to observe long-range proton to X-nucleus connectivity separated by 2-3 bonds, with some experiments going out to 4 or 5 bonds. In an HMBC experiment, direct one-bond correlations are suppressed as part of the sequence. The spectra of HMBC give rise to cross peaks that correlate which protons are coupled to what other specific X-nucleus is more than one bond away. The gradient HMBC (gHMBC) pulse sequence offers better suppression of interfering signals, making it particularly useful for analyzing complex molecules with overlapping signals.

Heteronuclear correlation spectroscopy is an analytical technique that investigates the coupling between different types of nuclei, often a proton and an ...

2D NMR: Heteronuclear Single-Quantum Correlation Spectroscopy (HSQC)

Heteronuclear single-quantum correlation spectroscopy (HSQC) is a 2D NMR technique that reveals one-bond correlations between hydrogen and a heteronucleus. The HSQC experiment is similar to the heteronuclear correlation experiment (HETCOR) but is more sensitive. In the HSQC spectrum, the proton chemical shift is plotted on the horizontal F2 axis, while the 13C chemical shift is plotted on the vertical F1 axis. The corresponding proton and 13C spectra are also shown. The HSQC contour plot does not have any diagonal peaks. All the cross-peaks indicate the protons directly attached to each carbon in a molecule. Similar to the COSY spectrum, imaginary lines are drawn in horizontal and vertical directions to identify the correlated peaks.
For example, the HSQC spectrum of 2-chlorobutane has a carbon signal at 11 ppm that can be assigned to the shielded methyl group and correlated to the proton multiplet at 1.01 ppm. The carbon signal at 24.8 ppm arises from the deshielded methyl group, which correlates to the proton multiplet at 1.52 ppm. Similarly, the methylene carbon signal at 33.3 ppm and methine carbon signal at 60.4 ppm correlate to the multiplets at 1.72 and 3.96 ppm, respectively.&#160; HSQC is a very useful technique for structurally elucidating complex molecules and is routinely used in protein NMR studies.

Heteronuclear single-quantum correlation spectroscopy (HSQC) is a 2D NMR technique that reveals one-bond correlations between hydrogen and a ...

2D NMR: Overview of Homonuclear Correlation Techniques

Homonuclear correlation spectroscopy (COSY) is a powerful technique used in Nuclear Magnetic Resonance (NMR) spectroscopy to study the correlations between nuclei of the same type within a molecule. It provides information about scalar couplings between adjacent nuclei, which helps determine connectivity and structural information. There are several COSY variants, each with its unique strengths and experimental parameters.
COSY90 is the standard two-dimensional (2D) COSY experiment that utilizes a second 90-degree pulse to achieve high sensitivity and resolution. It excels in analyzing small to medium-sized molecules and provides information on directly coupled protons. COSY45, similar to COSY90, uses 45-degree pulses instead of 90-degree pulses. This results in reduced sensitivity but improved resolution.
Long-range COSY (LR-COSY) extends the COSY experiment to detect scalar couplings between nuclei further apart in the molecule. It achieves this by combining multiple pulse sequences and magnetization transfers.
Relayed COSY is a variant of COSY that adds extra pulses to the standard pulse sequence to produce cross-peaks between cross-peaks, showing specific molecular connections hidden by overlapping signals.
TOCSY (Total Correlation Spectroscopy), also known as HOHAHA (Homonuclear Hartmann-Hahn Spectroscopy), reveals all through-bond connectivity between all coupled nuclei. TOCSY is especially useful for analyzing molecules with overlapping signals and complex coupling patterns.
NOESY (Nuclear Overhauser Effect Spectroscopy) measures the nuclear overhauser effect, which arises from dipole-dipole interactions between nuclei. It provides information about spatial proximity and can be used to determine the three-dimensional structure of a molecule.
ROESY (Rotating-frame Overhauser Enhancement Spectroscopy) is similar to NOESY but employs a different mechanism to obtain through-space correlations. It provides information about spatial proximity and is particularly useful for studying molecules with weak NOE signals.
In conclusion, choosing a COSY variant depends on the molecule or reaction under investigation and the desired information. The right COSY variant can be determined based on molecular size, coupling complexity, and the need for spatial or long-range connectivity data.

Homonuclear correlation spectroscopy (COSY) is a powerful technique used in Nuclear Magnetic Resonance (NMR) spectroscopy to study the correlations ...

Insensitive Nuclei Enhanced by Polarization Transfer (INEPT)

Insensitive Nuclei Enhanced by Polarization Transfer (INEPT) is an advanced Nuclear Magnetic Resonance (NMR) technique specifically designed to detect and enhance the signals of low-abundance nuclei, such as carbon-13 and nitrogen-15, in small molecules. The fundamental principle behind INEPT is the transfer of polarization from a more abundant and highly polarizable nucleus, typically hydrogen-1, to the low-abundance nucleus of interest. This process effectively boosts the NMR signal of the low-abundance nuclei, making them more easily detectable.
The INEPT technique involves a series of carefully timed radiofrequency (RF) pulses applied to the sample. These RF pulses excite the more abundant nuclei, causing them to align their spins in a specific manner. Through the process of spin coupling, the polarization of the more abundant nuclei is then transferred to the low-abundance nuclei. As a result, the NMR signal of these low-abundance nuclei is significantly enhanced, allowing for a more detailed analysis of the molecular structure.
Various pulse sequences have been developed to improve the observability of these low-abundance nuclei when coupled to a high-receptivity nucleus. The INEPT pulse sequence combines a spin echo and selective population inversion, which includes 90&#176; and 180&#176; pulses on the high-sensitivity (the I spins) and low-sensitivity nuclei (the S spins), respectively. Coupling-constant-based delays between pulses facilitate magnetization transfer through space or bond interactions. Additional RF pulses and delays invert the low-gamma magnetization, producing an observable NMR signal. The net result is an enhanced NMR signal from low-gamma nuclei that would otherwise be challenging to detect.
Various pulse sequences have been developed to improve the detection of low-abundance nuclei when coupled with high-receptivity nuclei such as protons. The INEPT sequence yields enhanced signals for insensitive nuclei, with half of the CH group producing negative peaks and the other half positive peaks. This pattern allows for discrimination between different types of carbon-hydrogen bonds within the molecule.
Decoupling methods can be employed to enhance sensitivity and resolution in distinguishing various carbon-hydrogen bonds, making INEPT an invaluable tool in the chemical and pharmaceutical industries.

Insensitive Nuclei Enhanced by Polarization Transfer (INEPT) is an advanced Nuclear Magnetic Resonance (NMR) technique specifically designed to detect and ...

Two-Dimensional (2D) NMR: Overview

The 1D NMR spectrum of large and complex molecules like natural products has complicated splitting patterns and overlapping signals, which can be easily interpreted using 2-dimensional (2D) NMR. Unlike 1D NMR, 2D NMR has two frequency axes that provide the coupling information between the nucleus A and nucleus B in a molecule. The process from which 2D spectra are obtained has four steps.
The first step is the preparation period, during which nucleus A is excited with a radiofrequency pulse. The second step is the evolution or wait period t1, which is incremented systematically, and no data is observed during this period. The next step is the mixing period, in which a second radiofrequency pulse is introduced, which transfers the magnetization to the spins of nucleus B. In the last step, the magnetization of nuclear spins from B is detected during the acquisition time t2 for each t1. Time domains t1 and t2 are Fourier transformed into frequency domains f1 and f2, and these correspond to two dimensions of 2D spectra, while the third dimension is the intensity. In 2D experiments, coupling between the same kind of nucleus is called homonuclear 2D experiments, whereas coupling between two types of nucleus is called heteronuclear 2D experiments. 2D spectra can be displayed as stacked or contour plots. When presented as stacked plots, 2D spectra are difficult to interpret. The contour plot is the horizontal cross-section of a stacked plot where the size of the circles shows the signal intensity. Its interpretation is straightforward and it is preferred for data analysis.

The 1D NMR spectrum of large and complex molecules like natural products has complicated splitting patterns and overlapping signals, which can be easily ...

2D NMR: Homonuclear Correlation Spectroscopy (COSY)

Homonuclear correlation spectroscopy, or COSY, is a 2-dimensional NMR technique that provides information about coupled protons. Typically, the geminal and vicinal coupling are observed. For example, consider the COSY spectrum of ethyl acetate, where its 1D proton NMR spectrum is plotted along the vertical and horizontal axes with their corresponding chemical shift scale. Three spots on the diagonal corresponding to the three peaks in the 1D proton spectrum are called diagonal peaks. The COSY spectrum is symmetric about the diagonal, with signals above and below the diagonal called cross-peaks or off-diagonal peaks. An imaginary line is drawn from diagonal peaks parallel to the horizontal axis, leading to a cross peak. A vertical line is then drawn from the same cross peak towards the diagonal peak to correlate the peaks. The off-diagonal peaks correlating the multiplets at 1.25 and 4.2 ppm indicate that the methyl protons are coupled to the methylene protons. The signal at 2 ppm is not associated with cross-peaks because the protons are not involved in homonuclear coupling. A COSY spectrum is useful when overlapping multiplets complicate the corresponding 1D spectrum.

Homonuclear correlation spectroscopy, or COSY, is a 2-dimensional NMR technique that provides information about coupled protons. Typically, the geminal ...

Double Resonance Techniques: Overview

Double resonance techniques in Nuclear Magnetic Resonance (NMR) spectroscopy involve the simultaneous application of two different frequencies or radiofrequency pulses to manipulate and observe two distinct nuclear spins. One important application of double resonance is spin decoupling, which selectively suppresses coupling with one type of nucleus while observing the NMR signal from another nucleus, simplifying the spectrum and enhancing resolution.
Spin decoupling is usually achieved by irradiating the sample atoms with a suitable radio frequency (rf) pulse sequence, effectively eliminating all the coupling with one nuclide. This simplifies the observed spectrum, making it easier to analyze and understand the relationships between different nuclei.
Double resonance experiments can be classified as heteronuclear or homonuclear, depending on whether the two sets of nuclei are of different isotopes or the same isotope, respectively. They can also be selective or nonselective, depending on whether the irradiating frequency covers only a portion or all of the resonance frequencies.
In nonselective heteronuclear decoupling, samples are exposed to an appropriate radiofrequency range to remove all coupling with one nuclide. However, increased external field strengths necessitate more powerful irradiation across broader frequency ranges. In certain instruments, continuous irradiation creates enough heat to cause damage to thermally sensitive samples.
To overcome these problems, modern methods using a series of pulses and exact timing delays, like J-modulated spin echo pulse sequences, can be employed to eliminate or adjust coupling effects within the spectrum.
For example, the attached proton transfer (APT) experiment applies a J-modulated spin echo pulse sequence to focus on the phase of detected carbon signals. Carbon atoms attached to an even number of protons exhibit positive signals in the spectrum, while those bonded to an odd number of protons appear as negative signals.
It utilizes a combination of a 180&#176; proton pulse and broadband decoupling to simplify spectral interpretation and assign multiplicities. The 180&#176; pulse is applied to the protons during the APT experiment. Its role is to refocus the spin coupling evolution that naturally occurs due to interactions between protons and carbons.
Specifically, after the 90&#176; pulse creates transverse magnetization, the 180&#176; pulse ensures that the effects of coupling are frozen during the initial period where the decoupler is turned off. This means the chemical shifts evolve only during the time 1/J&#8203; (the coupling constant period) after the first 180&#176; pulse.
By carefully timing this pulse sequence, the experiment isolates carbon multiplicities by utilizing the J-coupling between carbons and their attached protons. After the coupling evolution period (1/J&#8203;), broadband decoupling is turned on. This removes the J-coupling signals, collapsing multiplets into single peaks for each carbon resonance.
The decoupling ensures that carbon signals are free of splitting, allowing for a clear differentiation of signals based on phase (positive or negative) rather than splitting patterns.
The APT technique selectively enhances carbon signals, providing valuable information about carbon-proton connectivity, the number of attached hydrogen atoms, and the overall molecular structure.

Double resonance techniques in Nuclear Magnetic Resonance (NMR) spectroscopy involve the simultaneous application of two different frequencies or ...

Nuclear Overhauser Enhancement (NOE)

Irradiation of a spin-active nucleus causes an increase or decrease in the signal intensity of neighboring nuclei that are not necessarily chemically bonded or involved in J-coupling. &#160;This phenomenon, called the Nuclear Overhauser Enhancement (NOE), results from through-space interactions between the nuclear spins. The NOE effect decreases with increasing internuclear distance and is generally not observed beyond 4 angstroms. In NOE, dipole-dipole interactions between neighboring spin-active nuclei result in the transfer of nuclear spin polarization. These interactions can cause an increase or decrease in the signal intensity, which results in a positive or negative NOE, respectively.
NOE can be applied to improve the signal intensity of less sensitive nuclei such as carbon-13. Proton-decoupled carbon-13 spectra show a positive NOE effect, where the carbon signal intensities are substantially increased compared to those in proton-coupled spectra.
Targeted irradiation of specific nuclei can also reveal through-space proximity, which helps confirm stereochemistry and verify spectral peak assignments. The NOE effect is also applied in 2D NMR experiments, such as Nuclear Overhauser Effect Spectroscopy (NOESY), to determine the 3D structure of proteins.

Irradiation of a spin-active nucleus causes an increase or decrease in the signal intensity of neighboring nuclei that are not necessarily chemically ...

&sup1;H NMR of Labile Protons:  Deuterium (&sup2;H) Substitution

This lesson illustrates the role of deuterium substitution in simplifying the NMR spectrum of compounds comprising labile protons. One method employed is the use of deuterium. Amongst the three isotopes of hydrogen, deuterium (2H) has a nucleus composed of one proton and one neutron. When the D2O solvent is added to a pure dry ethanol solution, its labile proton is substituted with deuterium.
<img alt="Figure1" src="/files/ftp_upload/12280/12280-PT_Figure_1.svg" style="text-align: center; height: 700px;" />
Figure 1. The comparison of the proton NMR spectra of pure dry ethanol and the same in D2O solvent.
The signals from deuterium are not observed in a proton NMR spectrum, as deuterium&#8211;proton coupling is negligible, and no spin-spin splitting occurs between them. As shown in Figure 1, the NMR spectra of pure ethanol and ethanol in deuterium, the disappearance of the triplet in the latter, confirms that it corresponds to the labile &#8211;OH proton. Furthermore, the methylene protons that initially showed up as a multiplet transform to a quartet, proving that the multiplet is due to the coupling with the &#8211;OH proton and the methyl protons.

This lesson illustrates the role of deuterium substitution in simplifying the NMR spectrum of compounds comprising labile protons. One method employed is ...

&sup1;H NMR of Conformationally Flexible Molecules: Variable-Temperature NMR

The axial and equatorial protons in cyclohexane can be distinguished by performing a variable-temperature NMR experiment. In this process, except for one proton, the remaining eleven protons are replaced by deuterium. The deuterium substitution avoids the possible peak splitting caused by the spin-spin coupling between the adjacent protons. The remaining proton flips between the axial and equatorial positions.
<img alt="Figure1" src="/files/ftp_upload/13016/13016-PT_Figure_1.svg" style="text-align: center; height: 480px;" />
Figure 1. The temperature-dependent proton NMR spectra of cyclohexane.
Figure 1 depicts the proton NMR spectrum of the deuterium substituted sample, recorded at various temperatures. At room temperature, the rapid ring flipping of cyclohexane results in a single sharp peak. As the temperature is lowered to &#8722;60&#176;C, the rate of chair-chair interconversion reduces, resulting in the broadening of the peak.
Further lowering of the temperature broadens the peak, forming a saddle that splits into two peaks. On reaching a temperature lower than &#8722;89&#176;C, two sharp, well-resolved peaks corresponding to the equatorial and axial protons are formed. The peaks corresponding to the equatorial and axial protons occur at &#948; 1.62 and 1.14, respectively. At such low temperatures, the rate of chair-chair interconversion is reduced significantly, enabling the detection of the two distinct sets of protons on the NMR time scale.

The axial and equatorial protons in cyclohexane can be distinguished by performing a variable-temperature NMR experiment. In this process, except for one ...

&sup1;H NMR of Labile Protons: Temporal Resolution

Protons bonded to heteroatoms such as nitrogen and oxygen exhibit a range of chemical shift values. This is due to the varying degree of hydrogen bonding between the proton and the heteroatom in other molecules. The extent of hydrogen bonding affects the electron density around the proton, thereby giving different chemical shift values for the protons in the proton NMR spectrum.
The &#8211;OH proton in alcohols typically appears in the range of &#948; 2 to 5 ppm but can vary depending on the specific alcohol and conditions. This &#8211;OH proton undergoes rapid proton exchange with other molecules and is referred to as a labile proton. So, the exact &#948; value of the &#8211;OH proton and the spin-spin coupling involving the &#8211;OH proton and the other protons in the alcohol depends on the rate of the &#8211;OH proton exchange. The proton exchange rate, in turn, depends on multiple factors, including the purity of the alcohol sample, temperature, and solvent.
<img alt="Figure1" src="/files/ftp_upload/12279/12279-PT_Figure_1.svg" style="text-align: center; height: 350px;" />
Figure 1. The triplet of a &#8211;OH proton in the proton NMR spectrum of neat ethanol.
For example, the &#8211;OH proton exchange in a pure dry ethanol sample is very slow on the NMR time scale, giving enough time for the spin-spin coupling. Consequently, as depicted in Figure 1, the proton NMR spectrum of pure dry ethanol shows a triplet for the &#8211;OH proton due to the spin-spin coupling with adjacent methylene protons. The methylene protons are seen as a multiplet due to the coupling with the &#8211;OH proton and the methyl protons.
The presence of trace amounts of an acid or base increases the proton exchange rate. The proton exchange becomes rapid, and the NMR spectrometer only records an average of all the possible environments for the &#8211;OH proton.
<img alt="Figure2" src="/files/ftp_upload/12279/12279-PT_Figure_2.svg" style="text-align: center; height: 325px;" />
Figure 2. The broad singlet of a &#8211;OH proton in the proton NMR spectrum of neat ethanol.
As a result, as recorded in Figure 2, the &#8211;OH proton exhibits a broad singlet. The protons from the adjacent methylene group present a quartet where the splitting is caused only by the adjoining methyl group.

Protons bonded to heteroatoms such as nitrogen and oxygen exhibit a range of chemical shift values. This is due to the varying degree of hydrogen bonding ...

&sup1;H NMR of Conformationally Flexible Molecules: Temporal Resolution

At room temperature, the chair conformer of cyclohexane undergoes rapid ring flipping between two equivalent chair conformers at a rate of approximately 105 times per second. These two chair conformers are in equilibrium. The rapid ring flipping results in the interconversion of the axial proton to an equatorial proton and an equatorial to the axial proton. Such interconversions are too rapid and cannot be detected on the NMR timescale. Hence, the NMR spectrometer cannot distinguish between the axial and equatorial protons, resulting in a single peak at &#948; 1.4.
Similarly, NMR averages all the conformations of any molecule with rapid conformational equilibria. For example, the CH3 protons in bromoethane have a single resonance and coupling constant for splitting by the CH2 protons due to the rapid internal rotation of the carbon-carbon bond. Lastly, besides conformational equilibria, the time-averaging effect of NMR spectroscopy is also observed in some chemical reactions.

At room temperature, the chair conformer of cyclohexane undergoes rapid ring flipping between two equivalent chair conformers at a rate of approximately ...

Chemical Ionization (CI) Mass Spectrometry

The molecular ion peak of a molecule in the mass spectrum provides vital information for molecular identification. However, conventional electron impact ionization can lead to the rapid dissociation of some molecular ions before they reach the detector. A milder ionization method is required to increase the lifetime of such ionized analyte molecules. Chemical ionization (CI) is a gas-phase protonation reaction useful for mass-analyzing analyte molecules that are easily protonated to yield the corresponding conjugate acid. In this process, the sample is mixed with an excess reagent gas, which ensures the electron impact occurs primarily on the reagent gas. The charged species formed from the reagent protonates the analyte molecule, producing a relatively stable protonated analyte (conjugate acid) compared to the molecular ion. This results in an M+1 peak in the mass spectrum. The conjugate acid may then undergo fragmentation that generates additional signals.
For example, the CI of di-sec-butyl ether in methane gas illustrates this process. When the ether is mixed with excess methane gas as a reagent, electron impact occurs on methane rather than the ether. The resulting methane radical cation can react with another methane molecule to generate a methane radical and a methanium ion. The methanium ion is a source of gas-phase protons, which can protonate the ether to form its conjugate acid. The sequential reactions during the chemical ionization of di-sec-butyl ether are depicted in Figure 1.
<img alt="Figure1" src="/files/ftp_upload/12300/12300_PT_Figure_1.svg" style="text-align: center; height: 175px;" />
Figure 1: Chemical ionization of di-sec-butyl ether methane mixture.
This conjugate acid of the ether (m/z = 131) is relatively more stable than the molecular ion (m/z = 130) of ether formed via the conventional electron impact ionization. In the traditional route, the molecular ion undergoes fragmentation via &#945; cleavage, giving a signal at m/z = 101. Figure 2 illustrates the reactions that occur during electron impact ionization directly on di-sec-butyl ether.
<img alt="Figure2" src="/files/ftp_upload/12300/12300_PT_Figure_2.svg" style="text-align: center; height: 175px;" />
Figure 2: Electron impact ionization of di-sec-butyl ether and fragmentation of the molecular ion.
So, the mass spectra of di-sec-butyl ether ionized via CI feature an M+1 peak at m/z = 131. On the other hand, mass spectra of di-sec-butyl ether ionized via electron impact ionization do not show any peak at the m/z value of its molecular weight. Figures 3a and 3b show the mass spectra of di-sec-butyl ether ionized via the electron impact and chemical ionization methods, respectively.
<img alt="Figure3" src="/files/ftp_upload/12300/12300_PT_Figure_3.svg" style="text-align: center; height: 225px;" />
Figure 3:&#160;a) No m/z = 130 peak is visible in the mass spectrum obtained via electron impact ionization of di-sec-butyl ether. b) The m/z = 131 peak is clearly visible in the mass spectrum obtained via chemical ionization of di-sec-butyl ether.

The molecular ion peak of a molecule in the mass spectrum provides vital information for molecular identification. However, conventional electron impact ...

Mass Spectrometry: Alkyl Halide Fragmentation

Chlorine isotopes exist as 35Cl and 37Cl in a 3:1 ratio, while bromine isotopes exist as 79Br and 81Br in a 1:1 ratio. The mass spectrum of alkyl halides typically produces two distinct molecular ion peaks, the molecular ion peak, [M], and the molecular ion plus two, [M + 2] peak. The relative heights of these two peaks are proportional to the isotopic abundance ratios of the halide. For example, 2&#8208;chloropropane and 1&#8208;bromopropane display two peaks with relative peak heights in a 3:1 and 1:1 ratio, respectively.
Alkyl halides typically lose a non-bonding electron from the halogen to form molecular ions. The base peak results from the heterolytic cleavage of the carbon&#8211;halogen bond, where the bonding electrons go to the most electronegative atom, forming a cation and halogen atom. Interestingly, the &#9082;-cleavage is observed only in alkyl chlorides, not alkyl bromides. In alkyl chlorides, the&#160; C&#8211;Cl and C&#8211;C bonds exhibit similar strengths, while in alkyl bromides, the C&#8211;Br bond is weaker than the C&#8211;C bond. Consequently, the alkyl chlorides form a stable cation, where the positive charge is shared between the two atoms.
While less commonly discussed, fluoroalkanes and iodoalkanes exhibit unique fragmentation behavior. Fluoroalkanes, due to the strength of the C&#8211;F bond and the presence of only one isotope (19F), show limited fragmentation and lack isotopic peaks. Iodoalkanes, with their weak C&#8211;I bond and a single isotope (127I), predominantly fragment by losing iodine, resulting in simpler spectra with less isotopic splitting.

Chlorine isotopes exist as 35Cl and 37Cl in a 3:1 ratio, while bromine isotopes exist as 79Br and 81Br in a 1:1 ratio. The mass spectrum of alkyl halides ...

Electrospray Ionization (ESI) Mass Spectrometry

Higher molecular weight biomolecules are nonvolatile compounds that may decompose before ionizing or vaporizing during mass analysis with conventional electron impact ionization methods. Accordingly, electrospray ionization (ESI) is the favored method for vaporizing and ionizing biomolecules as it circumvents rapid fragmentation and enables the recording of mass signals for the entire biomolecule.
ESI utilizes electrical energy to transfer ions from the liquid phase of the sample into the gaseous phase. The analyte biomolecule is premixed with an ionic liquid&#8212;a nonmolecular compound serving as the ionization source. The solution is sprayed through a high-voltage capillary to generate a fine aerosol. The voltage difference applied between the capillary and the entrance of the analysis chamber causes the movement of charged droplets toward the analysis chamber. The ionic liquid from the aerosol evaporates during this movement, leaving behind a variably protonated or ionized analyte molecule. These charged species are detected in the mass spectrum at an m/z value equivalent to the sum of the analyte molecule&#39;s molecular mass and the ions&#39; molecular weight from the ionic liquid associated with the analyte molecule.
The position of mass signals varies depending on the type of cations present in the ionic liquid. For example, the presence of sodium ions in the ionic liquid leads to an (M+23) peak in the mass spectra, while the presence of a proton results in an (M+1) peak.

Higher molecular weight biomolecules are nonvolatile compounds that may decompose before ionizing or vaporizing during mass analysis with conventional ...

Matrix-Assisted Laser Desorption Ionization (MALDI)

Matrix-assisted laser desorption ionization (MALDI) is a powerful analytical technique used in mass spectrometry. It enables the identification and characterization of various biomolecules, including proteins, peptides, nucleic acids, and carbohydrates. MALDI spectrometry is widely employed in biological and medical research, as well as in fields like pharmacology and biochemistry.
The analyte of interest, a biomolecule or a mixture of biomolecules, is mixed with a suitable matrix material. The matrix is usually an organic compound, such as a small organic acid or a crystalline substance, that facilitates ionization. This analyte-matrix mixture is then deposited onto a target surface, inserted into the mass spectrometer, and dried. During drying, the matrix forms small crystals that incorporate the analyte molecules within their structure.
Once the sample is prepared, a pulsed laser is directed onto the target surface. The matrix molecules absorb the laser beam energy, causing them to heat up and vaporize rapidly. This process is known as laser desorption. As the matrix molecules vaporize, they carry the embedded analyte molecules. The vaporized analyte molecules become ionized through a process called proton transfer. The proton transfer occurs between the matrix and the analyte molecule. The matrix molecule donates a proton to the analyte molecule, resulting in the formation of protonated ions. The analyte ions are then accelerated by an electric field and further separated based on their mass-to-charge ratio in a time-of-flight mass analyzer.
The mass spectrum obtained from MALDI spectrometry provides valuable information about the mass and relative abundance of the analyzed biomolecules.

Matrix-assisted laser desorption ionization (MALDI) is a powerful analytical technique used in mass spectrometry. It enables the identification and ...

Mass Spectrometry: Carboxylic Acid, Ester, and Amide Fragmentation

The fragmentation patterns observed for compounds such as carboxylic acids, esters, and amides in the mass spectra include &#9082;-cleavage and McLafferty rearrangement. Fragmentation by &#9082;-cleavage preferentially occurs at the carbon-carbon bond at the &#9082;-position next to the carboxylic group to generate a neutral radical and a cation. Long chain compounds with hydrogen at their &#947;-carbon undergo McLafferty rearrangement to give a radical cation and a neutral alkene.
For example, the fragmentation of butyramide is demonstrated in Figure 1. The molecular ion peak of butyramide, which contains one nitrogen atom, shows an odd mass-to-charge ratio of 87. Fragmentation of butyramide molecular ion by &#9082;-cleavage produces a cation at a mass-to-charge ratio 44. In addition to &#9082;-cleavage, butyramide molecular ion also undergoes fragmentation via McLafferty rearrangement. The base peak at the mass-to-charge ratio 59 arises due to McLafferty rearrangement.
<img alt="Figure1" src="/files/ftp_upload/13051/13051_PT_Figure_1.svg" style="text-align: center; height: 250px;" />

The fragmentation patterns observed for compounds such as carboxylic acids, esters, and amides in the mass spectra include &#9082;-cleavage and McLafferty ...

Mass Spectrometry: Aldehyde and Ketone Fragmentation

In mass spectrometry, the fragmentation of aliphatic aldehydes and ketones generally occurs through three key mechanisms: &#945;-cleavage, inductive cleavage, and the McLafferty rearrangement.
<ol>
	<li>&#945;-Cleavage 
	&#945;-Cleavage is a common fragmentation in carbonyl compounds where the bond adjacent to the carbonyl group is broken. This process produces an alkyl radical and an acylium cation, which is often detected in the mass spectrum due to its stability.</li>
	<li>Inductive Cleavage 
	In inductive cleavage, fragmentation yields an acyl radical and an alkyl cation. This occurs when electrons are drawn toward the carbonyl, weakening adjacent bonds and resulting in a distinctive fragmentation pattern. For example, in the mass spectrum of 5-methyl-2-hexanone, inductive cleavage produces an alkyl cation at a mass-to-charge (m/z) ratio of 71.</li>
	<li>McLafferty Rearrangement 
	The McLafferty rearrangement is a specific fragmentation pattern for carbonyl compounds with &#947;-hydrogen (hydrogen on the third carbon from the carbonyl group). The molecule undergoes a six-membered cyclic transition in this rearrangement, yielding a radical cation and a neutral alkene. For 5-methyl-2-hexanone, this rearrangement results in a peak at m/z 58.</li>
</ol>
Example: Fragmentation of 5-methyl-2-hexanone 
In the mass spectrum of 5-methyl-2-hexanone, the molecular ion undergoes these fragmentation patterns:
<ol style="list-style-type: circle;">
	<li>Inductive cleavage produces an alkyl cation at m/z 71.</li>
	<li>&#945;-Cleavage results in the base peak at m/z 43.</li>
	<li>McLafferty rearrangement creates a distinct peak at m/z 58.</li>
</ol>
An additional diagnostic feature in aldehydes is the M&#8722;1 peak, which arises due to the &#945;-cleavage of the aldehyde proton. In mass spectrometric analysis, this peak can help identify aldehydes, specifically among other carbonyl compounds.
Understanding these fragmentation pathways is crucial for interpreting mass spectra, particularly in identifying functional groups and distinguishing between similar compounds.

In mass spectrometry, the fragmentation of aliphatic aldehydes and ketones generally occurs through three key mechanisms: &#945;-cleavage, inductive ...

Mass Spectrometry: Aromatic Compound Fragmentation

Upon ionization, aromatic compounds generate a molecular ion that is observed as a prominent peak in their mass spectra. For example, the molecular ion peak for benzene appears at a mass-to-charge ratio of 78, while toluene is observed at a mass-to-charge ratio of 92. The molecular ion benzene is highly stable and does not readily undergo further fragmentation due to the significant amount of energy required to disrupt the aromatic stability of the benzene ring. In contrast, the molecular ion of alkyl&#8208;substituted benzenes, such as toluene, can undergo fragmentation by losing a hydrogen atom, forming a benzylic carbocation. This carbocation can rearrange to form the resonance-stabilized tropylium cation, which appears in the mass spectra as a strong peak. In the case of toluene, this strong peak is observed at a mass-to-charge ratio of 91.

Upon ionization, aromatic compounds generate a molecular ion that is observed as a prominent peak in their mass spectra. For example, the molecular ion ...

Mass Spectrometry: Cycloalkene Fragmentation

The molecular ions of cycloalkenes undergo fragmentation via a retro-Diels&#8211;Alder reaction.

The reaction proceeds via the cleavage of two carbon-carbon bonds in the cycloalkene to yield ethene. The remaining part of the cycloalkene structure is a dienyl radical cation with a molecular weight of 28 u lower than the molecular ion. This fragmentation pathway is similar to the fragmentation of cycloalkanes releasing ethene, differing only in the resultant radical cation. An alkyl species forms from the cycloalkane, whereas a dienyl species originates from the cycloalkene.

Retro-Diels&#8211;Alder reactions of cycloalkenes are also similar to the McLafferty-rearrangement-type fragmentation observed in acyclic alkenes with hydrogen on the &#947; carbon. In both cases, cleavage occurs at two positions, yielding an ethene molecule and an alkenyl species. In acyclic alkenes, the cleavage occurs at one carbon-carbon bond and a carbon-hydrogen bond, along with rearranging hydrogen from one carbon to another. In cyclic alkenes, cleavage occurs at two carbon&#8211;carbon bonds without any atomic rearrangement. Figure 1 depicts the fragmentation of cyclohexene via a retro-Diels&#8211;Alder reaction.
<img alt="Figure1" src="/files/ftp_upload/13044/13044-PT_Figure_1.svg" style="text-align: center; height: 90px;" />
Figure 1: Fragmentation of cyclohexene via a retro-Diels&#8211;Alder reaction.
In addition to the retro-Diels&#8211;Alder reaction, branched cycloalkenes exhibit fragmentation via cleavage of the side chain to form a cycloalkene cation. For example, the fragmentation of 1-methyl-1-cyclohexene via a retro-Diels&#8211;Alder reaction and side-chain cleavage are shown in Figure 2.
<img alt="Figure2" src="/files/ftp_upload/13044/13044-PT_Figure_2.svg" style="text-align: center; height: 225px;" />
Figure 2: Fragmentation of 1-methyl-1-cyclohexene via (top) a retro-Diels&#8211;Alder reaction; (bottom) side-chain cleavage.
The corresponding signals of the isoprenyl radical cation and the cyclohexenyl cation are evident in the mass spectrum of 1-methyl-1-cyclohexene shown in Figure 3.
<img alt="Figure3" src="/files/ftp_upload/13044/13044-PT_Figure_3.svg" style="text-align: center; height: 250px;" />
Figure 3: Mass spectrum of 1-methyl-1-cyclohexene.

The molecular ions of cycloalkenes undergo fragmentation via a retro-Diels&#8211;Alder reaction.

The reaction proceeds via the cleavage of two ...

Mass Spectrometry: Alkyne Fragmentation

The fragmentation of alkynes preferentially occurs at the carbon&#8211;carbon bond between the &#945; and &#946; carbon of the alkyne bond to generate a 3-propynyl cation (or propargyl cation). In terminal alkynes, there is the only type of fragmentation that yields the 3-propynyl cation. The unsubstituted 3-propynyl cation exhibits a peak at a mass-to-charge ratio of 39. In internal alkynes, the 3-propynyl cation is substituted. For example, 2-pentyne fragments into methyl-substituted 3-propynyl cation, which subsequently features as a mass signal at the mass-to-charge ratio of 56. The 3-propynyl cation is resonance-stabilized, and the corresponding mass signal is intense in the mass spectrum of alkynes. Figure 1 shows the fragmentation of 1-pentyne into an ethyl radical and a resonance stabilized 3-propynyl cation.
<img alt="Figure1" src="/files/ftp_upload/13045/13045-PT_Figure_1.svg" style="text-align: center; height: 115px;" />
Figure 1: Fragmentation of 1-pentyne molecular ion to yield the 3-propynyl cation.
Another fragmentation pathway observed in terminal alkynes is the loss of hydrogen from the terminal sp carbon. This results in a mass signal with a mass-to-charge ratio of one unit less than the molecular ion. This M&#8211;1 peak is very intense and becomes the base peak in the mass spectra of many alkynes, so it can be used to identify alkynes.
<img alt="Figure2" src="/files/ftp_upload/13045/13045-PT_Figure_2.svg" style="text-align: center; height: 275px;" />
Figure 2: The mass spectrum of 1-pentyne.

The fragmentation of alkynes preferentially occurs at the carbon&#8211;carbon bond between the &#945; and &#946; carbon of the alkyne bond to generate a ...

Mass Spectrometry: Alcohol Fragmentation

Alcohols (R-OH) ionize to lose one non-bonded electron from the oxygen atom, forming molecular ions. Due to their tendency to fragment rapidly, the intensity of the molecular ion peak in the mass spectrum is weak or sometimes absent. The fragmentation patterns for alcohols occur in two ways, i.e. &#9082;-cleavage and dehydration. During &#9082;-cleavage, the bond at the &#9082;-position adjacent to the hydroxyl group cleaves to give a resonance-stabilized cation and a radical. However, intramolecular dehydration involves losing a water molecule from an alcohol, forming an alkene cation, which shows a peak at M&#8722;18. Consider the fragmentation of butanol as shown below. &#9082;-cleavage produces a base peak at a mass-to-charge ratio of 31. In the case of dehydration, the fragmentation forms an alkene radical cation at a mass-to-charge ratio of 56.
<img alt="Figure1" src="/files/ftp_upload/13046/13046-PT_Figure_1.svg" style="text-align: center; height: 175px;" />

Alcohols (R-OH) ionize to lose one non-bonded electron from the oxygen atom, forming molecular ions. Due to their tendency to fragment rapidly, the ...

Mass Spectrometry: Amine Fragmentation

Amines can be identified using mass spectroscopy based on their characteristic fragmentation patterns. The molecular ions of amines undergo fragmentation via &#9082;-cleavage. The &#9082;-cleavage of the carbon-carbon bonds in amines generates an alkyl radical and resonance-stabilized nitrogen-containing cation.
In amines, the number of nitrogen atoms affects the mass of the molecular ion, which is described by the nitrogen rule of mass spectrometry. This rule states that a compound containing a single or an odd number of nitrogen atoms produces a molecular ion with an odd molecular weight, while a compound with no or an even number of nitrogen atoms generates a molecular ion with an even molecular weight.
For example, the mass spectrum of 3-methyl-1-butanamine, which contains one nitrogen atom, displays a molecular ion having an odd mass-to-charge ratio of 87. Fragmentation of this molecular ion via &#9082;-cleavage produces a base peak, which features a mass signal at a mass-to-charge ratio of 30, corresponding with the loss of the 2-methyl propyl radical.
Similarly, the fragmentation of triethylamine via &#9082;-cleavage generates a cation at a mass-to-charge ratio of 86. The molecular ion peak shows an odd mass-to-charge ratio of 101, as shown below.
<img alt="Figure1" src="/files/ftp_upload/13048/13048_PT_Figure_1.svg" style="text-align: center; height: 105px;" />

Amines can be identified using mass spectroscopy based on their characteristic fragmentation patterns. The molecular ions of amines undergo fragmentation ...

Mass Spectrometry: Branched Alkane Fragmentation

This lesson delves into the mass spectrometry of branched alkane fragmentation. Branched alkanes possess secondary or tertiary carbon atoms, which generate relatively stable carbocations if the cleavage occurs at the branching point. The high stability of carbocations drives the instant fragmentation of branched alkanes. Accordingly, the branched alkane&#39;s molecular ion peak is very weak or invisible in the mass spectra, especially in comparison to a linear alkane.
<img alt="Figure1" src="/files/ftp_upload/13041/13041-PT_Figure_1.svg" style="text-align: center; height: 275px;" />
Figure 1. Fragmentation pathway of 2-methylbutane (top), neopentane (middle), and n-pentane (bottom) molecular ions.
Figure 1 shows the most feasible fragmentation pathway observed in 2-methyl butane, neopentane, and n-pentane molecular ions. 2-methyl butane and neopentane fragment to yield secondary and tertiary carbocations, respectively. The stability of these carbocations drives the fragmentation reaction, even though the co-produced methyl radical is relatively unstable. In contrast, the cleavage of n-pentane leading to the methyl radical is difficult since the stability of a primary carbocation is low.
<img alt="Figure2" src="/files/ftp_upload/13041/13041-PT_Figure_2.svg" style="text-align: center; height: 105px;" />
Figure 2. Fragmentation of 2,2-dimethylpentane.
As shown in Figure 2, the fragmentation of 2,2-dimethyl pentane involves the loss of either methyl or propyl radical, resulting in a tertiary carbocation. Here, the stability of the co-produced radical determines the cleaving bond. So, the cleavage that produces a propyl radical is favored, and the signal from the 2-methyl propyl carbocation becomes the base peak.

This lesson delves into the mass spectrometry of branched alkane fragmentation. Branched alkanes possess secondary or tertiary carbon atoms, which ...

Creating a Winogradsky Column: A Method to Enrich the Microbial Species in a Sediment Sample

Source: Elizabeth Suter1, Christopher Corbo1, Jonathan Blaize1 
1 Department of Biological Sciences, Wagner College, 1 Campus Road, Staten Island NY, 10301
The Winogradsky column is a miniature, enclosed ecosystem used for enriching sediment microbial communities, especially those involved in sulfur cycling. The column was first used by Sergei Winogradsky in the 1880s and has since been applied in the study of many diverse microorganisms involved in biogeochemistry, such as photosynthesizers, sulfur oxidizers, sulfate reducers, methanogens, iron oxidizers, nitrogen cyclers, and more (1,2).
The majority of microorganisms on Earth are considered unculturable, meaning that they cannot be isolated in a test tube or on a petri dish (3). This is due to many factors, including that microorganisms depend on others for certain metabolic products. The conditions in a Winogradsky column closely mimic a microorganism&#39;s natural habitat, including their interactions with other organisms, and allows for them to be grown in a lab. Therefor, this technique permits scientists to study these organisms and understand how they are important to Earth&#39;s biogeochemical cycles without having to grow them in isolation.
Earth&#39;s environments are full of microorganisms which thrive in all types of habitats, such as soils, ocean water, clouds, and deep-sea sediments. In all habitats, microorganisms depend on each other. As a microorganism grows, it consumes particular substrates, including carbon-rich fuels like sugars as well as nutrients, vitamins, and respiratory gases like oxygen. When these important resources run out, different microorganisms with different metabolic needs can then bloom and thrive. For example, in the Winogradsky column, microbes first consume the added organic material while depleting the oxygen in the bottom layers of the column. Once the oxygen is used up, anaerobic organisms can then take over and consume different organic materials. This consecutive development of different microbial communities over time is called succession (4). Microbial succession is important in a Winogradsky column, where microbial activity changes the chemistry of the sediment, which then affects activity of other microbes and so on. Many microorganisms in soils and sediments also live along gradients, which are transitional zones between two different types of habitats based on the concentrations of substrates (5). At the correct spot in the gradient, a microbe can receive optimal amounts of different substrates. As a Winogradsky column develops, it begins to mimic these natural gradients, particularly in oxygen and sulfide (Fig. 1).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10506/10506fig1.jpg" /> 
Figure 1: A representation of the oxygen (O2) and sulfide (H2S) gradients that develop in a Winogradsky column.
In a Winogradsky column, mud and water from a pond or wetland are mixed in a transparent column and allowed to incubate, typically in the light. Additional substrates are added to the column to give the community sources of carbon, usually in the form of cellulose, and sulfur. Photosynthesizers typically start to grow in the top layers of the sediment. These photosynthetic microorganisms are largely composed of cyanobacteria, which produce oxygen and appear as a green or red-brown layer (Fig. 2, Table 1). While photosynthesis produces oxygen, oxygen is not very soluble in water and it decreases below this layer (Fig. 1). This creates a gradient of oxygen, ranging from high concentrations of oxygen in the top layers to zero oxygen in the bottom layers. The oxygenated layer is called the aerobic layer and the layer without oxygen is called the anaerobic layer.
In the anaerobic layer, many different microbial communities can proliferate depending on the type and amount of substrates that are available, the source of the initial microbes, and the porosity of the sediment. At the bottom of the column, organisms that anaerobically break down organic matter can thrive. Microbial fermentation produces organic acids from the breakdown of cellulose. These organic acids can then be used by sulfate reducers, which oxidize those organics using sulfate, and produce sulfide as a byproduct. The activity of sulfate reducers is indicated if the sediment turns black, because iron and sulfide react to form black iron-sulfide minerals (Fig. 2, Table 1). The sulfide also diffuses upward, creating another gradient in which sulfide concentrations are high in the bottom of the column and low in the top of the column (Fig. 1).
Near the middle of the column, sulfur oxidizers take advantage of the supply of oxygen from above and sulfide from below. With the right amount of light, photosynthetic sulfur oxidizers can develop in these layers. These organisms are known as green and purple sulfur bacteria, and often appear as green, purple, or purple-red filaments and blotches (Fig. 2, Table 1). Green sulfur bacteria have a higher tolerance for sulfide and usually develop in the layer directly below purple sulfur bacteria. Above the purple sulfur bacteria, purple nonsulfur bacteria may also develop. These organisms photosynthesize using organic acids as electron donors instead of sulfide and often appear as a red, purple, orange, or brown layer. Nonphotosynthetic sulfur oxidizers can develop above the purple nonsulfur bacteria, and these usually appear as white filaments (Fig. 2, Table 1). Additionally, bubbles may also form in the Winogradsky column. Bubbles in the aerobic layers indicates the production of oxygen by the cyanobacteria. Bubbles in the anaerobic layers are likely due to the activity of methanogens, organisms which anaerobically break down organic matter and form methane as a byproduct.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Position in Column</td>
			<td>Functional group</td>
			<td>Organism Examples</td>
			<td>Visual Indicator</td>
		</tr>
		<tr>
			<td>Top</td>
			<td>Photosynthesizers</td>
			<td>Cyanobacteria</td>
			<td>Green or reddish-brown layer. Sometimes bubbles of oxygen.</td>
		</tr>
		<tr>
			<td rowspan="5"></td>
			<td>Nonphotosynthetic sulfur oxidizers</td>
			<td>Beggiatoa, Thiobacilus</td>
			<td>White layer.</td>
		</tr>
		<tr>
			<td>Purple nonsulfur bacteria</td>
			<td>Rhodomicrobium, Rhodospirilum, Rhodopseuodmonas</td>
			<td>Red, purple, orange, or brown layer.</td>
		</tr>
		<tr>
			<td>Purple sulfur bacteria</td>
			<td>Chromatium</td>
			<td>Purple, or purple-red layer.</td>
		</tr>
		<tr>
			<td>Green sulfur bacteria</td>
			<td>Chlorobium</td>
			<td>Green layer.</td>
		</tr>
		<tr>
			<td>Sulfate Reducing Bacteria</td>
			<td>Desulfovibrio, Desulfotomaculum, Desulfobacter, Desulfuromonas</td>
			<td>Black layer.</td>
		</tr>
		<tr>
			<td>Bottom</td>
			<td>Methanogens</td>
			<td>Methanococcus, Methanosarcina</td>
			<td>Sometimes bubbles of methane.</td>
		</tr>
	</tbody>
</table>
Table 1: The main groups of bacteria that may appear in a classical Winogradsky column, from top to bottom. Examples of organisms from each group are given, and the visual indicators of each layer of organisms are listed. Based on Perry et al. (2002) and Rogan et al. (2005).

Winogradsky Column to Enrich Microbial Species in a Sample

Création d'une colonne de Winogradsky : une méthode pour enrichir les espèces microbiennes dans un échantillon de sédiments.

Source: Elizabeth Suter1, Christopher Corbo1, Jonathan Blaize1
1 Department of Biological Sciences, Wagner College, 1 Campus Road, Staten Island NY, 
...

Serial Dilutions and Plating: Microbial Enumeration

Source: Jonathan F. Blaize1, Elizabeth Suter1, and Christopher P. Corbo1 
1 Department of Biological Sciences, Wagner College, 1 Campus Road, Staten Island NY, 10301
Quantitative assessment of prokaryotes can be onerous given their abundance, propensity for exponential proliferation, species diversity within a population, and specific physiological needs. Compounding this challenge, is the four-phase nature in which bacteria replicate (lag, log, stationary and death). The ability to accurately estimate microorganism concentration is necessary for successful identification, isolation, cultivation, and characterization (6). As such, microbiologists have employed serial dilution and various plating techniques for over a century to reliably quantify bacterial and viral load in clinical, industrial, pharmaceutical, and academic laboratory environments (2,4,6). Descriptions of this methodology first appeared in 1883 when the German scientist and physician Robert Koch published his work on infectious disease-causing agents (2). Often referred to as the father of modern bacteriology, Koch&#39;s forenamed techniques have become the gold standard for enumeration of microorganisms, culturable or otherwise, throughout the world.
Serial dilution is a systematic reduction of a known or unknown entity (a solute, organism, etc.) through successive re-suspension of an initial solution (solution0) into fixed volumes of a liquid diluent (blanks). These blanks usually consist of 0.45% saline, though the composition can be varied (7). While an experimenter can choose any volume for each diluent, it is most often a multiple of 10, facilitating logarithmic reduction of the sample. For example, solution0 contains a total of 100 E. coli cells suspended in 10 mL of nutrient broth. If 1 mL of solution0 is removed and added to 9 mL of saline (diluent1), the new solution (solution1) would contain 1/10th of the initial concentration of E. coli. In this example, the new solution (solution1) would contain 10 E. coli cells. Repeating this process by removing 1 mL of solution1 and adding it to another 9 mL of saline (diluent2) would yield solution2, containing only a single E. coli cell. Since each new solution (9 mL of diluent + 1 mL of solution) contains a total of 10mL, we can conclude that the dilution factor for this reduction is 10 or that this was a 10-fold serial dilution (Figure 1). Since we only began with 100 cells in this example and we are diluting by a factor of 10, only two steps are required to reach the absolute minimum concentration of 1 cell.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10507/10507fig1.jpg" /> 
Figure 1: Serial dilution of a stock solution. A 1 mL aliquot of the stock solution (solution0) is added to tube 1 which contains 9 mL of 0.45% saline (dilent1); the product of this mixture is solution1. Repeat by aliquoting 1 mL of the newly created solution1 and adding it to tube 2. Aliquoting and resuspension continues in this fashion until the final tube is reached, diluting the stock concentration by a factor of 10 each with each step. <a href="https://www.jove.com/files/ftp_upload/10507/10507fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Serial dilution is the simplest technique for obtaining manageable concentrations of a desired organism and it is complemented by petri dish streaking and spreading, just two of many plating techniques used by microbiologists. This benefit of this approach is that the experimenter can harvest pure strains of a single species or separate strains from a mixed population (7). Streaking is accomplished by introducing an organism to a solid medium (generally consisting of agarose) that it will grow upon if the appropriate nutrients are available. Gently sweeping a sterile inoculating loop across the medium (so that a subtle streak remains) in a rigid sinusoidal pattern will distribute the organism proportionally to the frequency of the experimenter&#39;s waveform. Dividing the Petri dish into thirds or fourths (quadrant streak) and decreasing the frequency of each streak as a new region of the dish is entered will gradually reduce the number of microorganisms that can occupy that region, producing single colonies instead of an unquantifiable bacterial lawn. Spread plating does not additionally dilute samples; a sterile glass spreader is used to distribute an aliquot of suspension media across an entire petri dish (Figure 2). The colonies that grow on the spread plate arise from a single cell and each colony on the dish can be counted to estimate the number of colony forming units per milliliter (CFU) in a given suspension, represented as CFU/mL (6) (Figure 3) Soft agar and replica plating are variations of the aforementioned techniques and allow for isolation of bacteriophage and mutant screening, respectively (1,7).
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10507/10507fig2.jpg" /> 
Figure 2: Plate streaking for bacterial enumeration and strain isolation. Label the bottom of a petri dish with identification information (bacteria name, date, media) and divide into thirds. After selecting an appropriate dilution of the stock sample, take a sterile (disposable or flamed) inoculating loop and submerge it the test tube (here, T3). Slightly raise the petri dish cover on one side so that only the inoculating loop can access the agar. Glide the inoculating loop across the top of the media in a zig-zag fashion being careful not to compromise the agar. Rotate the plate by roughly 1/3rd (~118&#176;) and reduce the frequency of zig-zag motion. Rotate a final time and reduce zig-zag frequency once more. <a href="https://www.jove.com/files/ftp_upload/10507/10507fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/10507/10507fig3.jpg" /> 
Figure 3: Spread plating. 1 g of the aerobic zone was resuspended in T1 and then serially diluted. A sterile glass or plastic disposable spreading rod is used to distribute inoculum throughout each dish. This was repeated with 1 g of the anaerobic zone. <a href="https://www.jove.com/files/ftp_upload/10507/10507fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
As with serial dilutions, a logarithmic scale is employed to express organismal concentration. The number of colonies grown in standard petri dishes measuring 100mm x15mm can be enumerated manually (or automated with the aid of computational processing) by identifying isolated clusters of growth. Counts that total fewer than 30 or greater than 300 should be defined as too few to count (TFTC) or too numerous to count (TNTC), respectively. In the case of the latter, a serial dilution should be performed to reduce concentration before restreaking a new petri dish. Averaging the number of self-contained colonies identified from three separate petri dishes and multiplying the mean by the dilution factor will yield CFU/mL; plotting the log10 of CFU/mL against time will reveal the mean generation time of the organism (7).

Dilutions en série et ensemencement des géloses : numération des micro-organismes

Source: Jonathan F. Blaize1, Elizabeth Suter1, and Christopher P. Corbo1
1 Department of Biological Sciences, Wagner College, 1 Campus Road, Staten Island ...

Enrichment Cultures: Culturing Aerobic and Anaerobic Microbes on Selective and Differential Medias

Source: Christopher P. Corbo1, Jonathan F. Blaize1, Elizabeth Suter1 
1 Department of Biological Sciences, Wagner College, 1 Campus Road, Staten Island NY, 10301
Prokaryotic cells are able to inhabit nearly every environment on this planet. As a kingdom, they possess a great metabolic diversity, allowing them to use a wide variety of molecules for energy generation (1). Therefore, when cultivating these organisms in the lab, all necessary and specific molecules required to make energy must be provided in the growth media. While some organisms are metabolically diverse, others are able to survive in extreme environments such as high or low temperatures, alkaline and acidic pH, reduced or oxygen absent environments, or environments containing high salt (2,3,4). Termed &#34;extremophiles&#34;, these organisms often require these intense environments to proliferate. When scientists look to grow such organisms, the media components as well as any specific environmental conditions all need to be taken into account in order to successfully cultivate the organisms of interest.
Scientists are able to grow culturable organisms in the lab because they understand the specific requirements that those species need to grow. However, culturable organisms account for less than 1% of species estimated to be on the planet (5). Organisms that we have detected by gene sequencing but are not able to grow in the lab are considered unculturable (6). At this time, we do not know enough about the metabolism and growth conditions of these organisms to replicate their environment in the lab.
Fastidious organisms lie somewhere in between the former two. These organisms are culturable, but they require very specific growth conditions, such as specific growth media components and/or specific growth conditions. Two examples of such genera are Neisseria sp. and Haemophilus sp., both of which require partially broken-down red blood cells (also known as chocolate agar), as well as specific growth factors and an environment rich in carbon dioxide (7). Without all of the required specific components, these organisms will not grow at all. Often, even with all of their requirements, these organisms grow poorly.
Unlike eukaryotic cells, which are only able to grow in an aerobic, or oxygen containing, environment, prokaryotic cells are able to grow anaerobically using several fermentation pathways to generate ample energy (8). Other prokaryotes prefer a microaerophilic, or reduced oxygen environment, or even a capnophilic, or high carbon dioxide environment (9). These organisms are more challenging to enrich for, since the atmosphere must be altered. Scientists that frequently work with organisms sensitive to an oxygenated environment would normally work in an anaerobic chamber and incubator, where a heavy, inert gas such as argon is pumped in to displace the oxygen (10). Others make use of conventionally available sealed gas packet systems that use water to generate hydrogen and carbon dioxide, along with a catalyst like palladium to remove all atmospheric oxygen. These commercially available kits can create any of the above-mentioned atmospheric conditions (10).
Whether cultivating a pathogen to determine potential infection or looking to identify a specific species of bacteria present in a natural environment, one problem exists. No one bacterial species inhabits one habitat. Bacteria live as multicellular communities everywhere from the skin of humans to the oceans of our planet (11). When attempting to isolate one species of bacteria, scientists must work to exclude the numerous other organisms that are also inhabiting the isolated area. For this reason, enriched growth media for bacteria often carry out two functions. The first is to make the media selective. A selective agent will prevent some species from growing, while not inhibiting and often even promoting others to grow (12). The second function of media ingredients may be to work as differential agents. Such agents allow for the identification of a particular biochemical feature of an isolated organism. By pairing several different selective and differential medias along with appropriate growth conditions, scientists and diagnosticians are able to identify the presence of specific bacterial species from a particular isolate.
One example of a selective and differential media aiding in to identification is in the case of the clinically significant organism Staphylococcus aureus. This organism is typically cultured on mannitol salt agar. This media not only selects for only organisms which can live in a high salt environment, which include some gram positives like Staphylococcus, but it also inhibits any organisms sensitive to salt. The mannitol sugar is the differential component of this medium. Of all the clinically significant Staphylococcus species, only S. aureus is able to ferment mannitol. This fermentation reaction produces acid as a by-product which causes the red methyl red indicator in the media to turn yellow. Other Staphylococcus species (such as Staphylococcus epidermidis) although able to grow, will leave the media red in color.
This lab exercise demonstrates proper aseptic technique, as well as proper inoculation of growth media from broth. It also introduces the growth of common contaminant organisms on enrichment media, the use of a gas package anaerobic culture system for anaerobic bacteria, and the use of different selective and differential medias for the presumptive identification of gram positive and gram-negative bacteria.

Enrichment Cultures, Selective and Differential Media

Cultures enrichies : Cultiver des micro-organismes aérobies et anaérobies dans des milieux sélectifs et différentiels

Source: Christopher P. Corbo1, Jonathan F. Blaize1, Elizabeth Suter1
1 Department of Biological Sciences, Wagner College, 1 Campus Road, Staten Island NY, ...

Pure Cultures and Streak Plating: Isolation of Single Bacterial Colonies from a Mixed Sample

Source: Tilde Andersson1, Rolf Lood1 
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 Lund, Sweden
Seemingly impossible to determine, microbial biodiversity is truly astounding with an estimated one trillion coexisting species (1,2). Although particularly harsh climates, like the acidic environment of the human stomach (3) or the subglacial lakes of Antarctica (4), may be dominated by a specific species, bacteria are typically found in mixed cultures. As each strain may influence the growth of another (5), the ability to separate and cultivate &#34;pure&#34; (consisting only of one type) colonies has become essential in clinical and academic settings alike. Pure cultures enable further genetic (6) and proteomic examinations (7), analysis of sample purity and, perhaps more noteworthy, the identification and characterization of infectious agents from clinical samples.
Bacteria have a wide range of growth requirements and there are numerous types of nutrient media designed to sustain both the un-demanding and the fastidious species (8). Growth media can be prepared either in liquid form (as a broth) or in a typically agar-based (a gelling agent derived from red algae) solid form. Whereas direct inoculation into broth carries the risk of generating a genetically diverse or even mixed bacterial population, plating and re-streaking creates a purer culture where each cell has a highly similar genetic makeup. The streak plate technique is based on progressive dilution of a sample (Figure 1), with the aim of separating individual cells from one another. Any viable cell (hereafter referred to as a colony forming unit, CFU) sustained by the media and designated environment can subsequently found an isolated colony of daughter-cells through binary fission. In spite of the rapid mutation rates within bacterial communities, this cell-group is generally regarded as clonal. Harvesting and re-streaking this population consequently ensures that subsequent work involves only a single bacterial type.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10509/10509fig1.jpg" /> 
Figure 1: A streak plate is based on progressive dilution of the original sample. I) The inoculum is initially dispersed using a zig-zag motion, creating an area with a relatively dense bacterial population. II-IV) Streaks are drawn from the preceding area, using a sterile inoculation loop each time, until the fourth quadrant is reached. V) A final zig-zag motion directed towards the middle of the plate forms a region where the inoculum has been markedly diluted, allowing colonies to appear separate from one another.
The streak plate technique can also be combined with the use of selective and/or differential media. A selective medium will inhibit the growth of certain organisms (e.g. through addition of antibiotics) whilst a differential medium will solely help distinguish one from another (e.g. through hemolysis on blood agar plates).
Underlying all work in microbiology is the use of aseptic (sterile) techniques. Every bacterial culture should be considered potentially pathogenic as there is a risk of unintended growth of treacherous strains, aerosol formation and contamination of equipment/personnel. To minimize these risks, all media, plastic-, metal- and glass-ware are typically sterilized through autoclaving before and after use, subjecting them to high-pressure saturated steam at around 121&#176;C that effectively wipes out any lingering cells. The work space is generally disinfected using ethanol both prior to, and after, use. Lab coat and gloves are always worn during work with infectious agents.

Pure Cultures and Streak Plating: Isolation of Bacterial Colonies

Cultures pures et ensemencement des géloses : isolement des colonies bactériennes pures à partir d'un échantillon mixte

Source: Tilde Andersson1, Rolf Lood1
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 ...

16S rRNA Sequencing: A PCR-based Technique to Identify Bacterial Species

Source: Ewa Bukowska-Faniband1, Tilde Andersson1, Rolf Lood1 
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 Lund, Sweden
Planet Earth is a habitat for millions of bacterial species, each of which has specific characteristics. Identification of bacterial species is widely used in microbial ecology to determine biodiversity of environmental samples and medical microbiology to diagnose infected patients. Bacteria can be classified using conventional microbiology methods, such as microscopy, growth on specific media, biochemical and serological tests, and antibiotic sensitivity assays. In recent decades, molecular microbiology methods have revolutionized bacterial identification. A popular method is 16S ribosomal RNA (rRNA) gene sequencing. This method is not only faster and more accurate than conventional methods, but also allows identification of strains that are difficult to grow in laboratory conditions. Furthermore, differentiation of strains at the molecular level enables discrimination between phenotypically identical bacteria (1-4).
16S rRNA joins with a complex of 19 proteins to form a 30S subunit of the bacterial ribosome (5). It is encoded by the 16S rRNA gene, which is present and highly conserved in all bacteria due to its essential function in ribosome assembly; however, it also contains variable regions which may serve as fingerprints for particular species. These features have made the 16S rRNA gene an ideal genetic fragment to be used in identification, comparison, and phylogenetic classification of bacteria (6).
16S rRNA gene sequencing is based on the polymerase chain reaction (PCR) (7-8) followed by DNA sequencing (9). PCR is a molecular biology method used to amplify specific fragments of DNA through a series of cycles that include:
i) Denaturation of a double stranded DNA template 
ii) Annealing of primers (short oligonucleotides) that are complementary to the template 
iii) Extension of primers by the DNA polymerase enzyme, which synthesizes a new DNA strand
A schematic overview of the method is shown in Figure 1.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10510/10510fig1.jpg" /> 
Figure 1: Schematic overview of the PCR reaction. <a href="https://www.jove.com/files/ftp_upload/10510/10510fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
There are several factors that are important for a successful PCR reaction, one of which is quality of the DNA template. Isolation of chromosomal DNA from bacteria can be performed using standard protocols or commercial kits. Special care should be taken to obtain DNA that is free of contaminants that can inhibit the PCR reaction.
Conserved regions of the 16S rRNA gene permit the design of universal primer pairs (one forward and one reverse) that can bind to and amplify the target region in any bacterial species. The target region can vary in size. While some primer pairs can amplify most of the 16S rRNA gene, others amplify only parts of it. Examples of commonly used primers are shown in Table 1 and their binding sites are depicted in Figure 2.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer name</td>
			<td>Sequence (5&#39;&#8594;3&#39;)</td>
			<td>Forward/ reverse</td>
			<td>Reference</td>
		</tr>
		<tr>
			<td>8F b)</td>
			<td>AGAGTTTGATCCTGGCTCAG</td>
			<td>forward</td>
			<td>-1</td>
		</tr>
		<tr>
			<td>27F</td>
			<td>AGAGTTTGATCMTGGCTCAG</td>
			<td>forward</td>
			<td>-10</td>
		</tr>
		<tr>
			<td>515F</td>
			<td>GTGCCAGCMGCCGCGGTAA</td>
			<td>forward</td>
			<td>-11</td>
		</tr>
		<tr>
			<td>911R</td>
			<td>GCCCCCGTCAATTCMTTTGA</td>
			<td>reverse</td>
			<td>-12</td>
		</tr>
		<tr>
			<td>1391R</td>
			<td>GACGGGCGGTGTGTRCA</td>
			<td>reverse</td>
			<td>-11</td>
		</tr>
		<tr>
			<td>1492R</td>
			<td>GGTTACCTTGTTACGACTT</td>
			<td>reverse</td>
			<td>-11</td>
		</tr>
	</tbody>
</table>
Table 1: Examples of standard oligonucleotides used in amplification of 16S rRNA genes a). 
a) The expected lengths of the PCR product generated using the different primer combinations can be estimated by calculating the distance between the binding sites for the forward and the reverse primer (see Figure 2), e.g. the size of the PCR product using primer pair 8F-1492R is ~1500 bp, and for primer pair 27F-911R ~900 bp. 
b) also known as fD1
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10510/10510fig2.jpg" /> 
Figure 2: Representative figure of the 16S rRNA sequence and the primer-binding sites. Conserved regions are colored in grey and variable regions are filled with diagonal lines. To allow for the highest resolution, primer 8F and 1492R (name based on location on rRNA sequence) are used to amplify the whole sequence, allowing for the sequencing of several variable regions of the gene. <a href="https://www.jove.com/files/ftp_upload/10510/10510fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Cycling conditions for PCR (i.e. the temperature and time required for the DNA to be denatured, annealed with primers, and synthesized) are dependent on the type of polymerase that is used and the properties of the primers. It is recommended to follow the manufacturer&#39;s guidelines for a particular polymerase.
After the PCR program is completed, the products are analyzed by agarose gel electrophoresis. A successful PCR yields a single band of expected size. The product must be purified prior to sequencing to remove residual primers, deoxyribonucleotides, polymerase, and buffer which were present in the PCR reaction. The purified DNA fragments are usually sent for sequencing to commercial sequencing services; however, some institutions perform DNA sequencing at their own core facilities.
The DNA sequence is automatically generated from a DNA chromatogram by a computer and must be carefully checked for quality, as manual editing is sometimes needed. Following this step, the gene sequence is compared with sequences deposited in the 16S rRNA database. The regions of similarity are identified, and the most similar sequences are delivered.

16S rRNA Sequencing: Identifying Bacterial Species by PCR

Séquençage de l'ARNr 16S : une technique basée sur la PCR pour l'identification d'espèces bactériennes

Source: Ewa Bukowska-Faniband1, Tilde Andersson1, Rolf Lood1
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, ...

Growth Curves: Generating Growth Curves Using Colony Forming Units and Optical Density Measurements

Source: Andrew J. Van Alst1, Rhiannon M. LeVeque1, Natalia Martin1, and Victor J. DiRita1 
1 Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, Michigan, United States of America
Growth curves provide valuable information on bacterial growth kinetics and cell physiology. They allow us to determine how bacteria respond in variable growth conditions as well as to define optimal growth parameters for a given bacterium. An archetypal growth curve progresses through four stages of growth: lag, exponential, stationary, and death (1).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10511/10511fig1.jpg" /> 
Figure 1: Bacterial growth curve. Bacteria grown in batch culture progress through four phases of growth: lag, exponential, stationary, and death. Lag phase is the period of time it takes for the bacteria to reach a physiological state capable of rapid cell growth and division. Exponential phase is the stage of fastest cell growth and division during which DNA replication, RNA transcription, and protein production all occur at a constant, rapid rate. Stationary phase is characterized by a slowing down and plateauing of bacterial growth due to nutrient limitation and/or toxic intermediate accumulation. Death phase is the stage during which cell lysis occurs as a result of severe nutrient limitation.
Lag phase is the period of time it takes for the bacteria to reach a physiological state capable of rapid cell growth and division. This lag occurs because it takes time for bacteria to adjust to their new environment. Once the necessary cellular components are generated in lag phase, bacteria enter the exponential phase of growth where DNA replication, RNA transcription, and protein production all occur&#160;at a constant, rapid rate (2). The rate of rapid cell growth and division during the exponential phase is calculated as the generation time, or doubling time, and is the fastest rate at which the bacteria can replicate under the given conditions (1). The doubling time can be used to compare different growth conditions to determine which is more favorable for bacterial growth. The exponential growth phase is the most reproducible growth condition as bacterial cell physiology is consistent throughout the entire population (3). Stationary phase follows the exponential phase where cell growth plateaus. Stationary phase is brought on due to nutrient depletion and/or accumulation of toxic intermediates. Bacterial cells continue to survive in this stage, although the rate of replication and cell division is drastically reduced. The final phase is death, where severe nutrient depletion leads to the lysing of cells. Features of the growth curve that provide the most information include the duration of lag phase, the doubling time, and the maximum cell density reached.
Quantification of bacteria in batch culture can be determined using both colony forming units and optical density measurements. Enumeration by colony forming units (CFU) provides a direct measurement of bacterial cell counts. The standard unit of measure for CFU is the number of culturable bacteria present per 1 mL of culture (CFU/mL) determined by serial dilution and spread plating techniques. For each timepoint, a 1:10 dilution series of the batch culture is performed and 100 &#181;l of each dilution is spread plated using a cell spreader.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10511/10511fig2.jpg" /> 
Figure 2. Serial dilution plating schematic. General flowthrough for dilution plating from batch culture. The batch culture is serially diluted 1:10 by transferring 1 mL &#160;of the previous dilution into the subsequent tube containing 9ml PBS. From each dilution tube, 100 &#181;l is spread plated using a plate spreader which is an additional dilution of 1:10 as it is 1/10th the volume of 1 mL volume when calculating CFU/mL. Plates are incubated and enumerated once clonal colonies grow on the plates.
The plates are then incubated overnight and clonal colonies enumerated. The dilution plate which grew 30-300 colonies is used to calculate the CFU/mL for the given timepoint (4, 5). Stochastic variation in colony counts under 30 are subject to greater error in the calculation of CFU/mL and counting colonies greater than 300 can be underestimated due to colony crowding and overlapping. Using the dilution factor for the given plate, the CFU of the batch culture can be calculated for each timepoint.
Optical density gives an instant approximation of bacterial cell count measured using a spectrophotometer. The optical density is a measure of absorbance of light particles that pass through 1cm of culture and detected by a photodiode sensor (6). The optical density of a culture is measured in relation to a media blank and increases as bacterial density increases. For bacterial cells, a wavelength of 600 nm (OD600) is typically used when measuring optical density (4). By generating a standard curve relating colony forming units and optical density, the optical density measurement can be used to readily approximate the bacterial cell count of a batch culture. However, this relationship begins to deteriorate as early as 0.3 OD600 as cells begins to change shape and accumulate extracellular products in the media, influencing the optical density reading as it relates to CFU (7). This error becomes more pronounced during stationary and death phases.
Here, Escherichia coli is grown in Luria-Bertani (LB) broth at 37&#176;C over the course of 30 hours (7). Both CFU/mL and optical density growth curves have been generated&#160;as well as the standard curve relating optical density to CFU.&#160;
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/10511/10511fig3.jpg" /> 
Figure 3. Escherichia coli optical density at 600 nm wavelength (OD600) growth curve. Optical density values were taken directly from the spectrophotometer after blanking with sterile LB media. OD600 values greater than 1.0 were diluted 1:10 by combining 100 &#181;l culture with 900 &#181;l fresh LB, again measured, and then multiplied by 10 to obtain the OD600 value. This step is taken as the accuracy in measurement of the spectrophotometer is reduced at high cell density. From the curve, lag phase extends to around 1h of growth, transitions to exponential phase from 2h to 7h, then begins to plateau, entering stationary phase. Death phase is not a stark transition, however, as optical density gradually begins to decline after 15h.
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/10511/10511fig4.jpg" /> 
Figure 4. Escherichia coli colony forming unit per milliliter (CFU/mL) growth curve. CFU/mL values for each timepoint were calculated from the dilution plate that contained 30-300 colonies. From the curve, lag phase extends out to around 2h of growth, transitions to exponential phase from 2h to 7h, then begins to plateau, entering stationary phase. Death phase is not a stark transition, however, as CFU/mL gradually begins to decline after 15h from a peak of 2 x 109 to approximately 5 x 108 at 30 hours.
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/10511/10511fig5.jpg" /> 
Figure 5. Standardization curve for CFU/mL versus OD600. A linear regression can be used to relate these units so that optical density may be used to approximate bacterial cell density. Optical density can be used to provide and instant approximation of the CFU/mL of the batch culture. Here, only the first six timepoints are plotted as the relationship between OD600 and CFU/mL is less accurate beyond 1.0 OD600 as cell shape and extracellular products begin to accumulate as the bacteria enter stationary phase, which occurs shortly after reaching 1.0 OD600. Changes in cell shape and extracellular products in the media influence the optical density reading and therefore the relationship between optical density and the number of bacteria in the culture is also impacted.
The doubling time has also been determined to be 15 minutes and 19 seconds. From this data, the capacity for growth in LB for E. coli can be visualized and be used for comparison between different media or bacteria.

Growth Curves, CFU and Optical Density Measurements

Courbes de croissance : Générer des courbes de croissance en comptant les unités formant colonies (UFC) et en mesurant l'absorbance

Source: Andrew J. Van Alst1, Rhiannon M. LeVeque1, Natalia Martin1, and Victor J. DiRita1
1 Department of Microbiology and Molecular Genetics, Michigan ...

Antibiotic Susceptibility Testing: Epsilometer Tests to Determine MIC Values of Two Antibiotics and Evaluate Antibiotic Synergy

Source: Anna Bl&#228;ckberg1, Rolf Lood1 
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 Lund Sweden
Knowledge of the interactions between antibiotics and bacteria is important in understanding how microbes evolve antibiotic resistance. In 1928, Alexander Fleming discovered penicillin, an antibiotic that exerts its antibacterial function by interfering with cell wall regeneration (1). Other antibiotics with diverse mechanisms of action have subsequently been discovered, including drugs that inhibit DNA replication and protein translation in bacteria; however, no new antibiotics have been developed in recent years. Resistance to current antibiotics has been increasing, resulting in severe infectious diseases that cannot be effectively treated (2). Here, we describe several methods to assess antibiotic resistance in bacterial populations. Each of these methods works, regardless of the mechanism of action of the antibiotics used, because bacterial death is the measured outcome. Antibiotic resistance is not only rapidly disseminated specifically through hospital settings, but also throughout society. In order to investigate such means of resistance, different methods have been developed including the Epsilometer test (E-test) and the broth dilution test (3).
The E-test is a well-established method and is a cost-effective tool that quantifies Minimal Inhibitory Concentration (MIC) data, the lowest concentration of an antimicrobial that inhibits visible growth of a microorganism. Depending on the bacterial strain and antibiotics used, the MIC value can vary between sub &#956;g/mL to &#62;1000 &#956;g/mL (4). The E-test is performed using a plastic strip containing a predefined antibiotic gradient, which is imprinted with the MIC reading scale in &#956;g/mL. This strip is directly transferred on the agar matrix when applied to the inoculated agar plate. After incubation, a symmetrical elliptic inhibition zone is visible along the strip as bacterial growth is prevented. MIC is defined by the area of inhibition, which is the endpoint where the ellipse intersects the strip. Another common method to determine MIC is the microbroth dilution method. Microbroth dilution incorporates different concentrations of the antimicrobial agent added to a broth medium containing inoculated bacteria. After incubation, MIC is defined as the lowest concentration of antibiotic that prevents visible growth (5). It is also a quantitative method and can be applied to several bacteria. Disadvantages of this method include the possibility of errors when preparing the concentrations of the reagents and the large number of reagents required for the experiment. Measuring antibiotic resistance is imperative from both a clinical and research perspective, and these in vitro methods of investigating resistance are discussed and showcased below.
The profile of resistance for a specific bacterium can be applied in order to optimize antibiotic treatment to determine whether a patient would benefit from combination treatment versus single therapy. For the usage of more than one antibiotic at a single time, it is imperative to know their interactions with each other and if they have an additive, synergistic, or antagonistic effect. An additive effect can be seen when the joint effect of the antibiotics equals the potency of the individual antibiotics given at an equal dose. Synergy between antibiotics, on the other hand, is present when the joint effect of the antibiotics is more potent than if the drug would be given alone (6). Applying combinations of antimicrobial treatment is used to avoid the occurrence of antimicrobial resistance thus to enhance the effect of the individual antibiotic treatment (7). Knowledge of antagonism is also as important to prevent unnecessary use of antimicrobial combinations. E-test methodology offers simple and several ways to determine possible synergy and antagonism between different antimicrobial agents. In order to face the proliferation of antibiotic resistant pathogens, knowledge of possible synergistic and antagonistic mechanisms of certain antibiotics is important resulting in clinical efficacy and battling multidrug-resistance.
Determination of synergy using E-tests can be divided into two broad approaches: cross and non-cross testing. While both synergy tests rely on the previous knowledge of individual MIC values, the two approaches are slightly different in methodology and conceptual approach. In a non-cross synergy test, the first antibiotic in the pair to be tested is placed on an agar plate inoculated with bacteria. After allowing the antibiotics from the first strip infuse the plate (e.g. after 1 hour), the strip is removed and a new strip containing the second antibiotic is placed on the exact same spot as the first, making sure to place the two individual MIC values on top of each other. The resulting inhibition zone can then be analyzed as described above, and synergy calculated based on the Equation 1.
Equation 1 - Fractional Inhibitory Concentrations (FIC)
<img src="/files/ftp_upload/10512/10512eq1.jpg" />
Values &#62;0.5 demonstrates synergy.
While rewarding the examiner with easy-to-analyze plates, the method is somewhat laborious and time-consuming due to the change of strips, as well as the need of using two plates per experiment. Instead, a cross test is often employed. Instead of adding the two different E-test strips subsequently on top of each other (after removal of the first), both are placed simultaneously but in the form of a cross (<img align="center" src="/files/ftp_upload/10512/10512eq3.jpg" /> 90&#176; angle), with the two previously determined MIC values forming the 90&#176; angle. By this approach only one plate is needed per synergy test, as well as less work, making it a preferred choice despite being slightly more difficult to analyze. The new MIC values in the combined antibiotics approach can be visualized as the modified inhibition zones, after which synergy can be determined by Equation 1.
Instead of using an agar plate approach, a microbroth approach can often be preferential due to its higher flexibility (e.g. ability to choose specific concentrations of antibiotics outside the limits of an E-test strip). Further, microbroth tests are suggested to be more sensitive due to their even distribution of antibiotics in a liquid solution, not depending on the dissociation within a solid phase (agar plate). Wells in a 96-well microplate will be inoculated with a set number of bacteria (106 cfu/mL: bacterial concentration can be estimated by OD600 nm measurements, turbidity standards, or by spread plating samples from 10x bacterial serial dilutions), and antibiotics in different dilutions will be added to the wells. Similarly, to the E-test strips MIC is determined as the intersection (well/spot) with the lowest concentration of antibiotics inhibiting visible growth of bacteria.
Experimental Aim
<ul>
	<li>The project below describes strategies to determine MIC-values of penicillin G and gentamicin of Streptococcus group G by two different methods, E-test and microbroth dilution. For E-test, Mueller-Hinton agar plates inoculated with Streptococcus group G were used in combination with gradient strips of penicillin G and/or gentamicin; while MH-broth with 50% lysed horse blood and 20 mg/mL &#946;-NAD were used with soluble antibiotics together with Streptococcus group G in a microbroth approach.</li>
</ul>
Materials
<ul>
	<li>Bacterial colonies on a blood agar plate, stored &#60;7 days in 4&#176;C</li>
	<li>Blood agar plates</li>
	<li>0.5 McFarland standard
	<ul>
		<li>1% BaCl2</li>
		<li>1% H2SO4</li>
	</ul>
	</li>
	<li>Saline tube (2 mL)</li>
	<li>Cotton tipped applicator</li>
	<li>Mueller-Hinton agar plates (MHA plates)</li>
	<li>MH broth with 50% lysed horse blood and 20 mg/mL &#946;-NAD (MH-F)</li>
	<li>E-test penicillin/gentamicin (or antibiotics of interest) (BioMerieux, Marcy l&#39;Etoile, France, Sweden)</li>
	<li>Antibiotics penicillin/gentamicin (or antibiotics of interest (powder/solution))</li>
</ul>
Note: The specific media used for bacterial growth may vary for different species.

Antibiotic Susceptibility Testing, MIC and Antibiotic Synergy

Tests de sensibilité aux antibiotiques : Utilisation du ETEST pour déterminer la CMI de deux antibiotiques et évaluer la synergie des antibiotiques

Source: Anna Bl&#228;ckberg1, Rolf Lood1
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 ...

Microscopy and Staining: Gram, Capsule, and Endospore Staining

Source: Rhiannon M. LeVeque1, Natalia Martin1, Andrew J. Van Alst1, and Victor J. DiRita1 
1 Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, Michigan, United States of America
Bacteria are diverse microorganisms found nearly everywhere on Earth. Many properties help distinguish them from each other, including but not limited to Gram-staining type, shape and arrangement, production of capsule, and formation of spores. To observe these properties, one can use light microscopy; however, some bacterial characteristics (for example size, lack of coloration, and refractive properties) make it hard to distinguish bacteria solely with a light microscope (1, 2). Staining bacteria is necessary when distinguishing bacterial types with light microscopy. The two main types of light microscopes are simple and compound. The main difference between them is the number of lenses used to magnify the object. Simple microscopes (for example a magnifying glass) have only one lens to magnify an object, while compound microscopes have several lenses to enhance magnification (Figure 1). Compound microscopes have an objective lens close to the object which collects light to create an image of the object. This is then magnified by the eyepiece (ocular lens) which enlarges the image. Combining the objective lens and eyepiece allows for higher magnification than using a single lens alone. Typically, compound microscopes have multiple objective lenses of varying powers to allow for different magnification (1, 2). Here, we will discuss visualizing bacteria with Gram stains, Capsule stains, and Endospore stains.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10513/10513fig1.jpg" /> 
Figure 1: A typical compound microscope. The most important parts of the microscope are labeled.
The Gram stain, developed in 1884 by the Danish bacteriologist Hans Christian Gram (1), differentiates bacteria based on the composition of the cell wall (1, 2, 3, 4). Briefly, a bacterial smear is placed on a microscope slide and then heat-fixed to adhere the cells to the slide and make them more readily accepting of stains (1). The heat-fixed sample is stained with Crystal Violet, turning the cells purple. The slide is flushed with an Iodine solution, which fixes the Crystal Violet to the cell wall, followed by a decolorizer (an alcohol) to wash away any non-fixed Crystal Violet. In the final step, a counterstain, Safranin, is added to color cells red (Figure 2). Gram-positive bacteria stain purple due to the thick peptidoglycan layer which is not easily penetrated by the decolorizer; Gram-negative bacteria, with their thinner peptidoglycan layer and higher lipid content, destain with the decolorizer and are counterstained red when Safranin is added (Figure 3). Gram staining is used to differentiate cells into two types (Gram-positive and Gram-negative) and is also useful to distinguish cell shape (spheres or cocci, rods, curved rods, and spirals) and arrangement (single cells, pairs, chains, groups, and clusters) (1, 3).

<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10513/10513fig2.jpg" /> 
Figure 2: Schematic of the Gram Staining Protocol. The left column shows how Gram-negative bacteria react at each step of the protocol. The right column shows how Gram-positive bacteria react. Also, shown are two typical bacterial cell shapes: the bacilli (or rods) and the cocci (or spheres).

<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/10513/10513fig3.jpg" /> 
Figure 3: Gram Staining Results. A Gram stain of a mixture of Staphylococcus aureus (Gram-positive purple cocci) and Escherichia coli (Gram-negative red rods).
Some bacteria produce an extracellular viscous outer layer called a capsule (3, 5). Capsules are protective structures with various functions, including but not limited to adherence to surfaces and other bacteria, protection from desiccation, and protection from phagocytosis. Capsules are typically composed of polysaccharides containing more than 95% water, but some may contain polyalcohols and polyamines (5). Due to their mostly non-ionic composition and tendency to repel stains, simple staining methods do not work with capsule; instead, capsule staining uses a negative staining technique which stains the cells and the background, leaving the capsule as a clear halo around the cells (1, 3) (Figure 4). Capsule staining involves smearing a bacterial sample into an acidic stain on a microscope slide. Unlike Gram staining, the bacterial smear is not heat-fixed during a Capsule Stain. Heat-fixing can disrupt or dehydrate the capsule, leading to false negatives (5). Furthermore, heat-fixing can shrink cells resulting in a clearing around the cell which can be mistaken as a capsule, leading to false positives (3). The acidic stain colors the slide background; while follow up with a basic stain, Crystal Violet, colors the bacterial cells themselves, leaving the capsule unstained and appearing as a clear halo between the cells and the slide background (Figure 5). Traditionally, India ink has been used as the acidic stain because these particles cannot penetrate the capsule. Therefore, neither the capsule nor the cell is stained by India ink; instead, the background is stained. Congo Red, Nigrosin, or Eosin can be used in place of India ink. Capsule staining can help doctors diagnose bacterial infections when looking at cultures from patient samples and guide appropriate patient treatment. Common diseases caused by encapsulated bacteria include pneumonia, meningitis, and salmonellosis.

<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/10513/10513fig4.jpg" /> 
Figure 4: Schematic of the Capsule Staining Protocol. The top panel shows the slide smear prior to any stain application. The middle panel shows how the slide and bacteria look after the primary stain, Congo Red. The final panel shows how the slide and bacteria look after the counterstain, Crystal Violet.

<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/10513/10513fig5.jpg" /> 
Figure 5: Capsule Staining Results. Capsule staining of encapsulated Acinetobacter baumannii (denoted with black arrows) and non-encapsulated Escherichia coli (denoted with white arrows). Notice the background is dark and A. baumannii cells are stained purple. The capsule around A. baumannii cells is evident as a halo, while E. coli has no halo.
In adverse conditions (for example nutrient limitation, extreme temperatures, or dehydration), some bacteria produce endospores, metabolically inactive structures that are resistant to physical and chemical damage (1, 2, 8, 9). Endospores allow the bacterium to survive harsh conditions by protecting the genetic material of the cells; once conditions are favorable for growth, spores germinate, and bacterial growth continues. Endospores are difficult to stain with standard staining techniques because they are impermeable to dyes typically used for staining (1, 9). The technique routinely used to stain endospores is the Schaeffer-Fulton Method (Figure 6), which uses the primary stain Malachite Green, a water soluble stain that binds relatively weakly to cellular material, and heat, to allow the stain to break through the cortex of the spore (Figure 7). These steps color the growing cells (termed vegetative cells in the context of endospore biology), as well as endospores and any free spores (those no longer within the former cell envelope). Vegetative cells are washed with water to remove Malachite Green; endospores retain the stain due to heating the Malachite Green within the spore. Finally, the vegetative cells are counterstained with Safranin to visualize (Figure 8). Staining for endospores helps differentiate bacteria into spore formers and non-spore formers, as well as determines whether spores are present in a sample which, if present, could lead to bacterial contamination upon germination.

<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/10513/10513fig6.jpg" /> 
Figure 6: Schematic of the Endospore Staining Protocol. The left column shows how spore forming bacteria react at each step of the protocol. The right column shows how non-spore forming bacteria react.

<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/10513/10513fig7.jpg" /> 
Figure 7: Diagram of Endospore Structure. Bacterial cell containing an endospore with the various spore structures labeled.

<img alt="Figure 8" class="xfigimg" src="/files/ftp_upload/10513/10513fig8.jpg" /> 
Figure 8: Endospore Staining Results. A typical staining of endospores of Bacillus subtilis. The vegetative cells (denoted with the white arrows) are stained red, while the endospores (denoted with the black arrows) are stained green.

Microscopy and Staining Techniques in Bacteria

Microscopie et coloration : Gram, Capsule et endospores.

Source: Rhiannon M. LeVeque1, Natalia Martin1, Andrew J. Van Alst1, and Victor J. DiRita1
1 Department of Microbiology and Molecular Genetics, Michigan ...

Plaque Assay: A Method to Determine Viral Titer as Plaque Forming Units (PFU)

Source: Tilde Andersson1, Rolf Lood1 
1 Department of Clinical Sciences Lund, Division of Infection Medicine, Biomedical Center, Lund University, 221 00 Lund, Sweden
Viruses that infect prokaryotic organisms, called bacteriophages or simply phages, were identified in the early 20th century by Twort (1) and d&#39;H&#233;relle (2) independently. Phages have since been widely recognized for their therapeutic value (3) and their influence on human (4), as well as global, ecosystems (5). Current concerns have fueled a renewed interest in the use of phages as an alternative to modern antibiotics in treatment of infectious disease (6). Essentially all phage research relies on the ability to purify and quantify viruses, also known as a viral titer. Initially described in 1952, this was the purpose of the plaque assay (7). Decades and multiple technological advancements later, the plaque assay remains one of the most reliable methods for determination of viral titer (8).
Bacteriophages subsist by injecting their genetic material into host cells, hijacking the machineries for production of new phage particles, and eventually causing the host to release numerous progeny virions through cell lysis. Because of their minute size, bacteriophages cannot be observed using solely light microscopy; therefore, scanning electron microscopy is required (Figure 1). Additionally, phages cannot be cultivated on nutritional agar plates like bacteria, as they need host cells to prey on.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10514/10514fig1.jpg" /> 
Figure 1: The morphology of a bacteriophage, here exemplified by an E. coli phage, can be studied using scanning electron microscopy. Most bacteriophages belong to Caudovirales (tailed bacteriophages). This particular phage has a very short tail structure and an icosahedral head, placing it in the family of Podoviruses.
The plaque assay (Figure 2) is based on incorporation of host cells, preferentially in log-phase growth, into the medium. This creates a dense, turbid layer of bacteria able to sustain viral growth. An isolated phage can subsequently infect, replicate within, and lyse one cell. With each lysed cell, multiple adjacent ones become immediately infected. Several cycles in, a clear zone (a plaque) can be observed in the otherwise turbid plate (Figure 2B/Figure 3A), indicating the presence of what was initially a single bacteriophage particle. The number of plaque forming units per volume (i.e. PFU/mL) of a sample, can thus be determined from the number of plaques generated.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10514/10514fig2.jpg" /> 
Figure 2: Testing for plaque forming units (PFU) is a common method for determining the number of bacteriophages in a sample. (A) The base of a sterile Petri dish is covered with an appropriate solid nutrient medium, followed by a mixture of soft media, susceptible host cells and a dilution of the original bacteriophage sample. Note that the phage-suspension could, in some cases, also be evenly spread-out across the surface of already solidified soft agar. (B) Growth of the host bacteria forms a lawn of cells in the top agar layer. Bacteriophage replication generates clear zones, or plaques, caused by host cell lysis.
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/10514/10514fig3.jpg" /> 
Figure 3: Results from PFU-testing show multiple plaques generated by bacteriophages. Due to lysis of susceptible host cells, plaques can be seen as clearing zones in the bacterial lawn, either with (A) full clearance, or (B) partial re-growth caused by generation of resistant bacteria (or possibly by temperate phages in the lysogenic cycle).
Certain temperate phages can adopt what is referred to as a lysogenic lifecycle, in addition to the formerly described lytic growth. In lysogeny, the virus assumes a latent state through incorporation of its genetic material into the genome of the host cell (9), often conferring resistance to further phage infections. This is sometimes revealed through a slight clouding of the plaque (Figure 3B). It is worth noting however, that plaques can also appear blurred due to re-growth of bacteria that have evolved resistance to the phage independent of previous phage infections.
Viruses can attach, or adsorb, to only a limited range of host bacteria (10). Host ranges are further limited by intracellular anti-viral strategies such as the CRISPR-Cas system (11). The resistance/sensitivity towards specific phages displayed by bacterial subgroups has historically been used to categorize bacterial strains into different phage types (Figure 4). Although the effectiveness of this method has now been surpassed by novel sequencing techniques, phage typing can still provide valuable information about bacteria-phage interactions, for instance, facilitating the design of a phage cocktail for clinical usage.
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/10514/10514fig4.jpg" /> 
Figure 4: Phage sensitivity of different bacterial strains. Soft agar plates with Cutibacterium acnes strain (A) AD27 and (B) AD35, were spotted with 21 different C. acnes bacteriophages. Only phage 11 were able to infect and kill AD27 while strain AD35 showed sensitivity towards all phages. This technique, termed phage typing, can be used to divide bacterial species and strains into different subgroups based on phage susceptibility.

Determining Viral Titer as Plaque Forming Units PFU

Test de la plaque : méthode de détermination de la charge virale exprimée en unités formant des plaques

Transformation of E. coli Cells Using an Adapted Calcium Chloride Procedure

Source: Natalia Martin1, Andrew J. Van Alst1, Rhiannon M. LeVeque1, and Victor J. DiRita1 
1 Department of Microbiology and Molecular Genetics, Michigan State University
Bacteria have the ability to exchange genetic material (DeoxyriboNucleic Acid, DNA) in a process known as horizontal gene transfer. Incorporating exogenous DNA provides a mechanism by which bacteria can acquire new genetic traits that allow them to adapt to changing environmental conditions, such as the presence of antibiotics or antibodies (1) or molecules found in natural habitats (2). There are three mechanisms of horizontal gene transfer: transformation, transduction, and conjugation (3). Here we will focus on transformation, the ability of bacteria to take up free DNA from the environment. In the laboratory, the transformation process has four general steps: 1) Preparation of competent cells, 2) Incubation of competent cells with DNA, 3) Recovery of cells, and 4) Plating of the cells for growth of the transformants (Figure 1).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10515/10515fig1.jpg" /> 
Figure 1: General steps of the transformation process. The transformation process has four general steps: 1) Preparation of competent cells, 2) Incubation with DNA, 3) Recovery of the cells and 4) Plating cells for growth of the transformants.
For transformation to occur, the recipient bacteria must be in a state known as competence. Some bacteria have the ability to become naturally competent in response to certain environmental conditions. However, many other bacteria do not become competent naturally, or the conditions for this process are yet unknown. The ability to introduce DNA into bacteria has a range of research applications: to generate multiple copies of a DNA molecule of interest, to express large amount of proteins, as a component in cloning procedures, and others. Because of the value of transformation to molecular biology, there are several protocols aimed to make cells artificially competent when conditions for natural competence are unknown. Two main methods are used to prepare artificially competent cells: 1) through chemical treatment of cells and 2) exposing the cells to electric pulses (electroporation). The former uses different chemicals depending on the procedure to create attraction between the DNA and the cell surface, while the latter uses electric fields to generate pores in the bacterial cell membrane through which DNA molecules can enter. The most efficient approach for chemical competence is incubation with divalent cations, most notably calcium (Ca2+) (4,5) Calcium-induced competence is the procedure that will be described here (6). This method is mainly used for transformation of Gram-negative bacteria, and that will be the focus of this protocol.
The procedure of chemical transformation involves a series of steps in which cells are exposed to cations to induce chemical competence. These steps are subsequently followed by a temperature change - heat shock - that favors the uptake of foreign DNA by the competent cell (7). The bacterial cell envelopes are negatively charged. In Gram-negative bacteria like Escherichia coli, the outer membrane is negatively-charged due to the presence of lipopolysaccharide (LPS) (8). This results in repulsion of the similarly negatively-charged DNA molecules. In chemical competence induction, positively-charged calcium ions neutralize this charge repulsion enabling DNA absorbance onto the cell surface (9). Calcium treatment and incubation with DNA are done on ice. Subsequently, an incubation at higher temperatures (42&#176;C), the heat shock, is performed. This temperature imbalance further favors the DNA uptake. Bacterial cells need to be at the mid-exponential growth phase to withstand the heat shock treatment; in other growth stages the bacterial cells are too sensitive to the heat resulting in loss of viability which significantly decreases transformation efficiency.
Different DNA sources can be used for transformation. Typically, plasmids, small circular, double-stranded DNA molecules, are used for transformation in most laboratory procedures in E. coli. For plasmids to be maintained in the bacterial cell after transformation, they need to contain an origin of replication. This allows them to be replicated in the bacterial cell independently from the bacterial chromosome. Not all the bacterial cells get transformed during the transformation procedure. Thus, transformation yields a mixture of transformed cells and non-transformed cells. To distinguish between these two populations, a selection method to identify the cells that have acquired the plasmid is used. Plasmids usually contain selectable markers, which are genes encoding a trait that confers an advantage for growth (i.e. resistance to an antibiotic or chemical or rescue from a growth auxotrophy). After transformation, bacterial cells are plated on selective media, which only allows for growth of the transformed cells. In the case of cells transformed with a plasmid conferring resistance to a given antibiotic, the selective media will be growth media containing that antibiotic. Several different methods can be used to confirm that the colonies grown in the selective media are transformants (i.e. have incorporated the plasmid). For example, plasmids can be recovered from these cells using plasmid preparation methods (10) and digested to confirm plasmid size. Alternatively, colony PCR can be used to confirm the presence of the plasmid of interest (11).
The aim of this experiment is to prepare E. coli DH5&#945; chemically competent cells, using an adaptation of the calcium chloride procedure (12), and to transform them with the plasmid pUC19 to determine transformation efficiency. The E. coli strain DH5&#945; is a commonly used strain in molecular biology applications. Because of its genotype, specifically the recA1 and endA1, this strain allows for increased insert stability and improve the quality of plasmid DNA in subsequent preparations. Since the transformation efficiency decreases with increasing size of the DNA, the plasmid pUC19 was used in this protocol because of its small size (2686 bp) (see https://www.mobitec.com/cms/products/bio/04_vector_sys/standard_cloning_vectors.html for a vector map). pUC19 confers resistance to ampicillin and thus, this was the antibiotic used for selection.

Transformation of E. coli: Adapted Calcium Chloride Procedure

Transformation des cellules E. coli en utilisant le chlorure de calcium

Source: Natalia Martin1, Andrew J. Van Alst1, Rhiannon M. LeVeque1, and Victor J. DiRita1
1 Department of Microbiology and Molecular Genetics, Michigan ...

Conjugation: A Method to Transfer Ampicillin Resistance from Donor to Recipient E. coli

Source: Alexander S. Gold1, Tonya M. Colpitts1 
1 Department of Microbiology, Boston University School of Medicine, National Emerging Infections Diseases Laboratories, Boston, MA
First discovered by Lederberg and Tatum in 1946, conjugation is a form of horizontal gene transfer between bacteria that relies on direct physical contact between two bacterial cells (1). Unlike other forms of gene transfer, such as transformation or transduction, conjugation is a naturally occurring process in which DNA is secreted from a donor cell to a recipient cell in a unidirectional manner. This directionality and the ability for this process to increase the genetic diversity of bacteria has given conjugation the reputation as a form of bacterial &#34;mating,&#34; which is believed to have contributed greatly to the recent rise in antibiotic resistant bacteria (2, 3). By using selective pressures, for example the use of antibiotics, conjugation has been manipulated for use in the laboratory setting, making it a powerful tool for horizontal gene transfer between bacteria, and in some cases from bacteria to yeast, plant, and animal cells (4). Apart from applications in the laboratory, bacterium-eukaryote gene transfer by conjugation is an exciting avenue of DNA transfer with a multitude of possible biotechnical applications and naturally occurring implications (5).
Conjugation is thought to work by a &#34;two-step mechanism&#34; (6). First, before any DNA can be transferred, the donor cell must make direct cell-to-cell contact with the recipient. This process has been characterized best in gram-negative bacteria, the most studied of which is Escherichia coli. Cell-to-cell contact is established by the presence of a complex network of extracellular filaments on the donor known as the sex pilus, a conjugative element encoded for by the transferable gene known as the F (fertility) factor (7, 8). In addition to establishing contact between donor and recipient, several proteins are transported via the sex pilus to the recipient cytoplasm, forming a type IV secretion system (T4SS) conduit between the two cells, a necessary structure for the second step of conjugation, DNA transfer (6). By combining this function of the sex pilus with rolling circle replication of DNA, the donor cell is able to transfer DNA in the form of a transposable element, such as a plasmid or transposon, to the recipient by a &#34;shoot and pump&#34; model (6). In this case, the &#34;shooting&#34; is the transport of the pilot protein, with linked DNA, by the T4SS into the recipient cell, and the &#34;pumping&#34; is the active transport of DNA to the recipient, a process reliant on the T4SS and catalyzed by coupling proteins (6). The machinery used in this this process is composed of an origin of transfer sequence (oriT), which must be provided by the DNA in cis and trans genes, which encode a relaxase, mate pair formation complex, and type IV coupling protein, and can be present in cis or trans (9). This relaxase cleaves the nic site within the oriT sequence and covalently attaches to the 5&#39; end of the transferred strand to produce the relaxosome, a single-stranded DNA-relaxase complex with other auxiliary proteins (9). Once formed, the relaxosome connects to the mating pair formation complex, via the type IV coupling protein, which allows for the transfer of the ssDNA-relaxase complex into recipient cells by the T4SS (10). Once in the cytoplasm of the recipient, the DNA can integrate into the recipient genome or exist separately in the form of a plasmid, either of which allow for the expression of its genes.
In this experiment, the widely used conjugation donor strain E. coli WM3064 was used to transfer the gene encoding for ampicillin resistance to the recipient strain E. coli J53. While both strains of the gram-negative bacteria were resistant to tetracycline, only the donor strain WM3064 had the gene for ampicillin resistance, encoded for in the pWD2-oriT shuttle vector, and was auxotrophic to diaminopimelic acid (DAP) (11-13). This experiment consisted of two main steps, the preparation of donor and recipient strains, followed by the transfer of the ampicillin resistance gene from donor to recipient by conjugation (Figure 1).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10516/10516fig1.jpg" /> 
Figure 1: Conjugation schematic. This schematic shows the successful transfer of a plasmid, only one example of a transposable DNA element, from a donor cell to a recipient cell using conjugation. Upon contact with the recipient cell by the donor cell via the sex pilus, the plasmid replicates by rolling circle replication, moves through the multiprotein complex joining the two cells, and forms a new full-length plasmid in the recipient cell.
By incubating a mixture of donor and recipient cells, then successively plating these cells in the presence of tetracycline and DAP, this allowed for the successful transfer of the ampicillin resistance gene. Successively plating cells grown from this mixture in the presence of tetracycline and ampicillin, removed all donor cells due to the lack of DAP and any recipient cells that may not have gained the ampicillin resistance gene, yielding strictly recipient J53 strain bacteria that acquired ampicillin resistance (Figure 2). Once carried out, the successful transfer of the ampicillin resistance gene was confirmed by PCR. Since conjugation was successful, the J53 strain of E. coli contained pWD2-oriT and was resistant to ampicillin, and the gene encoding for this resistance is detectable by PCR. However, if unsuccessful there would have been no detection of the ampicillin resistance gene and ampicillin would still function as an effective antibiotic against the J53 strain.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10516/10516fig2.jpg" /> 
Figure 2: Protocol schematic. This schematic shows an overview of the presented protocol.
<img alt="Figure 3A" class="xfigimg" src="/files/ftp_upload/10516/10516fig3a.jpg" /> 
Figure 3A: The confirmation of successful conjugation by PCR. A) Freezer stocks of the conjugated and negative control samples were streaked out on agar plates and a colony was selected (red) for DNA isolation.

Conjugation: Transferring Ampicillin Resistance in E. coli

Conjugaison : méthode de transfert de la résistance à l'ampicilline du donneur à l'hôte E. coli

Source: Alexander S. Gold1, Tonya M. Colpitts1
1 Department of Microbiology, Boston University School of Medicine, National Emerging Infections Diseases ...

Phage Transduction: A Method to Transfer Ampicillin Resistance from Donor to Recipient E. coli

Source: Alexander S. Gold1, Tonya M. Colpitts1 
1 Department of Microbiology, Boston University School of Medicine, National Emerging Infections Diseases Laboratories, Boston, MA
Transduction is a form of genetic exchange between bacteria that utilizes bacteriophages, or phages, a class of virus that infects exclusively prokaryotic organisms. This form of DNA transfer, from one bacterium to another by way of a phage, was discovered in 1951 by Norton Zinder and Joshua Ledererg, who termed the process &#34;transduction&#34; (1). Bacteriophages were first discovered in 1915 by British bacteriologist Frederick Twort, then independently discovered again in 1917 by French-Canadian microbiologist Felix d&#39;Herelle (2). Since then, the structure and function of these phages have been widely characterized (3), dividing these phages into two classes. The first of these classes are the lytic phages which upon infection multiply within the host bacterium, disrupting the bacterial metabolism, lysing the cell, and releasing progeny phage (4). As a result of this anti-bacterial activity and the increasing prevalence of antibiotic-resistant bacteria, these lytic phages have recently proved useful as a substitute treatment for antibiotics. The second of these classes are the lysogenic phages which can either multiply within the host via the lytic cycle or enter a quiescent state in which their genome is integrated into that of the host (Figure 1), a process known as lysogeny, with the ability for phage production to be induced in multiple later generations (4).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10517/10517fig1.jpg" /> 
Figure 1: Infection of host cell by bacteriophage. Adsorption by the phage to the bacterial cell wall via interactions between the tail fibers and receptor (purple). Once on the cell surface, the phage is irreversibly attached to the bacterial cell using the base plate (black) which is moved to the cell wall by the contractile sheath (yellow). Phage genome (red) then enters the cell and integrates into the host cell genome.
While bacterial transduction is a naturally occurring process, using modern technology it has been manipulated for the transfer of genes into bacteria in the laboratory setting. By inserting genes of interest into the genome of a lysogenic phage, such as phage, one is able to transfer these genes into the genomes of bacteria and consequently express them within these cells. While other methods of gene transfer, such as transformation, use a plasmid for gene transfer and expression, the insertion of the phage genome into that of the recipient bacterium not only has the potential to confer new traits to this bacterium, but also allows for naturally occurring mutations and other factors of the cellular environment to alter the function of the transferred gene.
Compared to other methods of horizontal gene transfer, such as conjugation, transduction is fairly flexible in the criteria required for donor and recipient cells. Any genetic element that can fit inside the genome of the phage being used can be transferred from any strain of donor bacteria to any strain of recipient bacteria as long as both are permissive to the phage, requiring the expression of necessary phage receptors on the cell surfaces. Once this gene is moved out of the donor genome and packaged into the phage, it can be transferred to the recipient. Following transduction, it is necessary to select for recipient bacteria that contain the gene of interest have to be selected for. This could be done by use of a genetic marker, such as a FLAG-tag or polyhistidine-tag, to mark the gene of interest, or the intrinsic function of the gene, in the case of genes that encode for antibiotic resistance. Additionally, PCR could be used to further confirm successful transduction. By using primers for a region within the gene of interest and comparing signal to a positive control, bacteria that has the gene of interest, and a negative control, bacteria that underwent the same steps as the transduction reaction with no phage. While bacterial transduction is a useful tool in molecular biology, it has and continues to play an important role in the evolution of bacteria, particularly with regard to the recent rise of antibiotic resistance.
In this experiment, bacterial transduction was used to transfer the gene encoding for resistance to the antibiotic ampicillin from the W3110 strain of E.coli to the J53 strain via the P1 bacteriophage (5). This experiment consisted of two main steps. First, the preparation of P1 phage containing the ampicillin resistance gene from the donor strain. Second, the transfer of this gene to the recipient strain by transduction with the P1 phage (Figure 1). Once carried out, the successful transfer of the ampicillin resistance gene could be determined by qPCR (Figure 2). If transduction was successful, the J53 strain of E. coli would be resistant to ampicillin, and the gene conferring this resistance detectable by qPCR. If unsuccessful, there would be no detection of the ampicillin resistance gene and ampicillin would still function as an effective antibiotic against the J53 strain.

<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10517/10517fig2.jpg" /> 
Figure 2: The confirmation of successful transduction by qPCR. By comparing the Cq values detected for the gene of interest from the transduction reaction and the negative control reaction, and normalizing these values against a housekeeping gene, one was able to confirm that bacterial transduction was successful.

Education Microbiology

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Education Microbiology

@media screen and (min-width: 320px){.css-u03n47{font-size:var(--chakra-fontSizes-xs);}}Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)

Science Education (Biologie avancée)