We acknowledge support from NIH New Innovator Award DP2 116520 and ORAU Ralph Powe Junior Faculty Enhancement Award.

1. Cell Maintenance
<ol>
 <li>H1 hESC (WiCell) were maintained on hESC qualified matrigel coated wells with mTeSR1 media, with media change every day. Wells were coated by dilute matrigel solution, prepared by adding 300 &mu;l of hESC matrigel in 25 ml of DMEM:F12. 1 ml of this matrigel solution was added to each well of a six well plate, or 400 &mu;l added to each well of a 12 well plate and allowed to coat for 1 hour at room temperature. Cells were mechanically passaged at a split ratio of 1:4 by scraping colonies once they reached between 1 and 1.5mm in diameter.</li>
 <li>RHMVEC (VEC technologies) was maintained in MCDB-131 media with media change every other day. Cells were split by trypsinization once 80% confluence was reached at a split ratio of 1:3. Endothelial cells between passages 3 and 7 were used for this study.</li>
</ol>
2. Preparation of Stock Solutions
<ol>
 <li>Activin A was reconstituted at 50 &mu;g/mL in sterile PBS containing 0.1% bovine serum albumin. The solution was aliquoted and stored at -20 &deg;C.</li>
 <li>EGF was reconstituted at 500 &mu;g/mL in sterile 10 mM Acetic Acid. The solution was aliquoted and stored at -20 &deg;C.</li>
 <li>Insulin was reconstituted at 10 mg/ml by adding acidified H2O (pH &le;2), prepared by addition of 0.1 ml glacial acetic acid to 10 ml of water.</li>
 <li>DAPT was reconstituted in DMSO at 18 mg/ml. It was further diluted to 300 &mu;M concentration in DMEM:F12, aliquoted and stored at -20 &deg;C.</li>
 <li>KAAD-Cyclopamine was reconstituted in DMSO at 5mg/ml. It was further diluted to 2 &mu;M concentration in DMEM:F12, aliquoted and stored at -20 &deg;C.</li>
 <li>All-trans retinoic acid was reconstituted at 2.7 mg/ml in 95% ethanol. It was further diluted to 2mM concentration in DMEM:F12, aliquoted and stored at -80 &deg;C.</li>
</ol>
3. Definitive Endoderm (DE) and Pancreatic Progenitor (PP) Induction
<ol>
 <li>Once hESC colonies reached between 1 and 1.5mm in diameter, DE induction was performed by adding DMEM:F12 supplemented with B27, 0.2% BSA, 100 ng/ml Activin A and 1 &mu;M Wortmannin for 4 days (Day 0-Day 4) with media change every day.</li>
 <li>After DE induction was complete, pancreatic progenitor induction was induced by changing the media to DMEM:F12 supplemented with B27, 0.2% BSA and KAAD-Cyclopamine at 0.2 &mu;M concentration for 24 hours (Day 4-Day 5).</li>
 <li>After 24 hours media was changed to DMEM:F12 supplemented with B27, 0.2% BSA, KAAD-Cyclopamine at 0.2 &mu;M concentration and all-trans retinoic acid at 2 &mu;M concentration for 3 days with media change every day (Day 5-Day 8).</li>
</ol>
4. Pancreatic Maturation
<ol>
 <li>After PP induction, all groups were changed to maturation media composed of DMEM:F12 supplemented with B27, 0.2% BSA, 10 mM Nicotinamide, 25 &mu;g/ml insulin, 30 nM Na2SeO3 and 50 &mu;g/ml transferrin for 2 days with media change every day (Day 8-Day 10).</li>
 <li>After 2 days in maturation media, the final maturation step is carried out in parallel using several different conditions for comparison. Differentiation was induced under the following conditions: (i) using notch inhibitor DAPT (ii) using co-culture media only, without endothelial cells as control and (iii) using contact co-culture with RHMVEC cells. Cells were maintained in DAPT or co-culture media for a week (Day 10-Day 17) with media change every day.
 <ol>
 <li>DAPT media was prepared by supplementing the maturation media with 30 &mu;M DAPT. Cells in this groups were first exposed to complete MCDB131 for 24 hours and then exposed to DAPT media for 6 days (Day 11-Day 17).</li>
 <li>Co-culture media was prepared by supplementing MCDB-131 media with B27, 0.2% BSA, 10 mM Nicotinamide, 10 ng/ml EGF, 1 &mu;g/ml hydrocortisone, 10 mg EndoGro, 90 &mu;g/ml heparin. For media control condition the differentiating cells were exposed to MCDB-131 complete medium for 24 hours (Day 10-Day 11) after which the media was changed to co-culture media for 6 days (Day 11-Day 17) (no endothelial cells).</li>
 <li>For contact co-culture condition, one million RHMVEC was added to the differentiating cells in complete MCDB-131 media (VEC technologies) for 24 hours (Day 10-Day 11) to allow attachment. After 24 hours media was changed to co-culture media for 6 days (Day 11-Day 17) with media change every day.</li>
 </ol>
 </li>
</ol>
5. qRT-PCR Analysis
<ol>
 <li>At the end of each stage of differentiation (endoderm; pancreatic progenitor; mature islet) were lysed and RNA was extracted using NucleoSpin RNA II extraction kit according to manufacturer's instructions.</li>
 <li>RNA quality was analyzed by checking RNA absorbance at 260 nm and 280 nm, followed by RNA quantification using a SmartSpec Plus spectrophotometer.</li>
 <li>Reverse transcription was performed using ImProm II reverse transcription kit according to manufacturer's instructions. All reactions were performed with 100 ng of RNA.</li>
 <li>qRT-PCR was performed using the Mx3005P QPCR system (Agilent) and Brilliant II SYBR Green QPCR master mix according to manufacturer's instructions. The primers used are listed on table 1. The initialization step was performed at 50 &deg;C for 2 minutes followed by 95 &deg;C for 10 minutes. 50 amplification cycles were performed as follows: 95 &deg;C for 30 seconds, 54 &deg;C for 30 seconds and 72 &deg;C for 1 minute.</li>
 <li>Fold change of target mRNA expression over undifferentiated cells was calculated from CT values using the following formulas: 
 &Delta;CT(Markeri)= CT(Markeri) - CT (GAPDH) 
 &Delta; &Delta;CT(Markeri)= &Delta;CT(Markeri)(Sample)- &Delta;CT(Markeri)(Undifferentiated cells) 
 Relative expression (Markeri)= 2-&Delta;&Delta;CT(markeri)</li>
</ol>
6. Immunocytochemistry
<ol>
 <li>At the end of each stage of differentiation (endoderm; pancreatic progenitor; mature islet) cells were fixed in 4% formaldehyde for 15 minutes at room temperature.</li>
 <li>Fixed cells were permeabilized using 0.25% Triton X-100 (TX) for 15 minutes.</li>
 <li>Non-specific staining was blocked by incubation in 10% donkey serum in 0.05% TX for 30 minutes.</li>
 <li>Primary antibody incubation was performed overnight at 4 &deg;C in blocking buffer at the recommended antibody dilution (see table 1).</li>
 <li>Cells were washed with 0.05% TX three times for 5 minutes.</li>
 <li>Secondary antibody incubation was performed for one hour at room temperature in the dark with appropriate antibodies diluted in blocking buffer.</li>
 <li>Cells were washed with 0.05% TX three times for 5 minutes.</li>
 <li>Nuclear staining was performed by incubation with Hoescht stain at 1:1000 dilution in PBS for 5 minutes followed by 3 washes with PBS.</li>
 <li>Fixed and stained cells were imaged using Olympus IX81 inverted microscope and Metamorph imaging software.</li>
</ol>
7. Representative Results
Addition of Activin A and Wortmannin to undifferentiated hESC for 4 days induces definitive endoderm as confirmed by qRT-PCR analysis for DE markers Sox17, Cxcr4, and Foxa2 and immunostaining for Sox17 as illustrated in Figure 2. Differentiation to pancreatic progenitor cells after addition of cyclopamine and retinoic acid was confirmed by qRT-PCR of pancreatic progenitor markers and Immunostaining for Pdx1 as illustrated in Figure 3.
At the final stage of differentiation, contact co-culture with RHMVEC cells strongly induced upregulation of insulin expression in the hESC derived pancreatic progenitor cells. The efficiency of co-culture mediated differentiation was analyzed by comparing with control condition using DAPT. DAPT was used as a positive control since it is currently one of the most widely used methods to achieve pancreatic maturation. Since the co-culture was performed in a modified media supplemented by factors supportive of endothelial cells, additional control was performed with the media in absence of endothelial cells to verify the effect of media on differentiation. Details of this analysis are presented in Figure 4.
<img alt="Figure 1." src="/files/ftp_upload/3759/3759fig1.jpg" /> 
Figure 1. Multi-stage protocol for differentiation of hESC into insulin expressing cells.
<img alt="Figure 2." src="/files/ftp_upload/3759/3759fig2.jpg" /> 
Figure 2. Definitive endoderm induction of human embryonic stem cells. A) qRT-PCR analysis of representative DE markers in hESC cells exposed to Activin A and Wortmannin for 4 days. Results are normalized with respect to undifferentiated hESC. B) Sox17 staining (Green) and DAPI (blue) show nuclear expression of Sox17. Scale bar: 50 &mu;m.
<img alt="Figure 3." src="/files/ftp_upload/3759/3759fig3.jpg" /> 
Figure 3. Pancreatic progenitor induction of the embryonic stem cell derived endoderm cells. A) qRT-PCR analysis of early pancreatic markers in hESC derived endoderm cells exposed to cyclopamine and retinoic acid for 4 days after DE induction. Results normalized with respect to undifferentiated hESC. B) Pdx1 staining (violet) and DAPI (blue) show nuclear expression of Pdx1. Scale bar: 50 &mu;m.
<img alt="Figure 4." src="/files/ftp_upload/3759/3759fig4.jpg" /> 
Figure 4. Pancreatic maturation stage A) qRT-PCR analysis of pancreatic hormones in hESC after pancreatic maturation using DAPT, contact co-culture or co-culture media (control). Results normalized with respect to undifferentiated hESC. p values obtained by student t-test. B) Co-culture with Dil-Ac-LDL labeled RHMVEC (Red) show regions where ECs attach to the plate if there are empty spaces (top), other RHMVEC can be found in direct contact with the differentiating ESC(bottom). C) C-peptide (Green) staining for cells differentiated using co-culture method. Scale bar: 12.5 &mu;m (Top) and 50 &mu;m (Bottom) D) Immunostaining of RHMVEC demonstrates no insulin expression in the RHMVEC.
<table border="1">
 <tbody>
 <tr>
 <td>Marker</td>
 <td>Primer1 (5' TO 3')</td>
 <td>Primer2 (5' TO 3')</td>
 <td>Ref</td>
 </tr>
 <tr>
 <td>SOX17</td>
 <td>CTCTGCCTCCTCCACGAA</td>
 <td>CAGAATCCAGACCTGCACAA</td>
 <td>12</td>
 </tr>
 <tr>
 <td>CXCR4</td>
 <td>CACCGCATCTGGAGAACCA</td>
 <td>GCCCATTTCCTCGGTGTAGTT</td>
 <td>4</td>
 </tr>
 <tr>
 <td>FOXA2</td>
 <td>GGAGCGGTGAAGATGGAA</td>
 <td>TACGTGTTCATGCCGTTCAT</td>
 <td>12</td>
 </tr>
 <tr>
 <td>PDX1</td>
 <td>AAGTCTACCAAAGCTCACGCG</td>
 <td>GTAGGCGCCGCCTGC</td>
 <td>4</td>
 </tr>
 <tr>
 <td>PTF1</td>
 <td>CATAGAGAACGAAACCACCCTTTGAG</td>
 <td>GCACGGAGTTTCCTGGACAGAGTTC</td>
 <td>12</td>
 </tr>
 <tr>
 <td>HLXB9</td>
 <td>CACCGCGGGCATGATC</td>
 <td>ACTTCCCCAGGAGGTTCGA</td>
 <td>4</td>
 </tr>
 <tr>
 <td>HNF6</td>
 <td>TGTGGAAGTGGCTGCAGGA</td>
 <td>TGTGAAGACCAACCTGGGCT</td>
 <td>5</td>
 </tr>
 <tr>
 <td>PAX6</td>
 <td>CGAATTCTGCAGGTGTCCAA</td>
 <td>ACAGACCCCCTCGGACAGTAAT</td>
 <td>5</td>
 </tr>
 <tr>
 <td>NKX6.1</td>
 <td>AGACCCACTTTTTCCGGACA</td>
 <td>CCAACGAATAGGCCAAACGA</td>
 <td>5</td>
 </tr>
 <tr>
 <td>ISL1</td>
 <td>GATCTATGTCACCTCGCAAGG</td>
 <td>TACAACCACCATTTCACTG</td>
 <td>12</td>
 </tr>
 <tr>
 <td>GLUCAGON</td>
 <td>AGGCAGACCCACTCAGTGA</td>
 <td>AACAATGGCGACCTCTTCTG</td>
 <td>4</td>
 </tr>
 <tr>
 <td>INSULIN</td>
 <td>AAGAGGCCATCAAGCAGATCA</td>
 <td>CAGGAGGCGCATCCACA</td>
 <td>12</td>
 </tr>
 </tbody>
</table>
Table 1. Primers used for qPCR reactions.

<ol>
	<li>De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Les+cellules+souches+embryonnaires+humaines+:+de+la+transgression+de+l'embryon+humain+&#225;+la+m&#233;decine+r&#233;g&#233;n&#233;ratrice+de+demain.">Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain &#225; la m&#233;decine r&#233;g&#233;n&#233;ratrice de demain.</a> Gyn&#233;cologie Obst&#233;trique &#38; Fertilit&#233;. 37, 620-626 (2009).</li><li>Murtaugh, L. C., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes,+Signals,+and+Lineages+in+Pancreas+Development.">Genes, Signals, and Lineages in Pancreas Development.</a> Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).</li><li>Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+definitive+endoderm+from+embryonic+stem+cells+in+culture.">Development of definitive endoderm from embryonic stem cells in culture.</a> Development. 131, 1651-1662 (2004).</li><li>D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat. Biotech. 24, 1392-1401 (2006).</li><li>Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+differentiation+of+human+ES+cells+and+iPS+cells+into+mature+pancreatic+insulin-producing+cells.">Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells.</a> Cell Res. 19, 429-438 (2009).</li><li>Basma, H., Soto-Guti&#233;rrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+and+Transplantation+of+Human+Embryonic+Stem+Cell-Derived+Hepatocytes.">Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes.</a> Gastroenterology. 136, 990-999 (2009).</li><li>Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -. P., Chipperfield, H., Tan, E. -. K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+Differentiation+of+Human+Embryonic+Stem+Cells+into+the+Pancreatic+Endocrine+Lineage.">Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage.</a> Stem Cells and Development. 16, 561-578 (2007).</li><li>Kim, S. K., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pancreas+development+is+promoted+by+cyclopamine,+a+Hedgehog+signaling+inhibitor.">Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor.</a> Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).</li><li>Docherty, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+and+development+of+the+islets+of+Langerhans:+implications+for+the+treatment+of+diabetes+mellitus.">Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus.</a> Current Opinion in Pharmacology. 1, 641-649 (2001).</li><li>Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., F&#228;ssler, R., Gu, G., Gerber, H. -. P., Ferrara, N., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Vascular+Basement+Membrane:+A+Niche+for+Insulin+Gene+Expression+and+[beta]&gt;+Cell+Proliferation.">The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]&gt; Cell Proliferation.</a> Developmental Cell. 10, 397-405 (2006).</li><li>Yoshitomi, H., Zaret, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+cell+interactions+initiate+dorsal+pancreas+development+by+selectively+inducing+the+transcription+factor+Ptf1a.">Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a.</a> Development. 131, 807-817 (2004).</li><li>Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Marked+differences+in+differentiation+propensity+among+human+embryonic+stem+cell+lines.">Marked differences in differentiation propensity among human embryonic stem cell lines.</a> Nat. Biotech. 26, 313-315 (2008).</li><li>Banerjee, I., Sharma, N., Yarmush, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+co-culture+on+pancreatic+differentiation+of+embryonic+stem+cells.">Impact of co-culture on pancreatic differentiation of embryonic stem cells.</a> J. Tissue Eng. Regen. Med. 5, 313-323 (2010).</li></ol>

We have nothing to disclose.

During pancreatic development, differentiating pancreatic cells are in close proximity with endothelial cells from the aorta; furthermore, pancreatic islets are densely vascularized to promote rapid exchange of blood glucose and islet hormones. Given these facts, it is not surprising that endothelial cells play an important role in the process of pancreatic organogenesis. While the importance of endothelial cells during pancreatic development is increasingly being appreciated, its role in in vitro differentiatio...

<table border="1">
	<tbody>
		<tr>
			<td>Name of the reagent</td>
			<td>Company</td>
			<td>Catalogue number</td>
			<td>Concentrations</td>
		</tr>
		<tr>
			<td>mTeSR1 (with supplement)</td>
			<td>Stem cell Technologies</td>
			<td>5850</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>hESC qualified matrigel</td>
			<td>BD Biosciences</td>
			<td>354277</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>DMEM:F12</td>
			<td>Invitrogen</td>
			<td>11330-032</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>MCDB-131</td>
			<td>Invitrogen</td>
			<td>10372019</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>MCDB-131 (Complete)</td>
			<td>VEC Technologies</td>
			<td>MCDB-131</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>B27 Supplement</td>
			<td>Invitrogen</td>
			<td>17504044</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Activin A</td>
			<td>R&amp;D</td>
			<td><a href="http://www.rndsystems.com/pdf/338-ac.pdf">338-AC</a></td>
			<td>100ng/ml</td>
		</tr>
		<tr>
			<td>Wortmannin</td>
			<td>Invitrogen</td>
			<td>W3144</td>
			<td>1&mu;M</td>
		</tr>
		<tr>
			<td>KAAD-Cyclopamie</td>
			<td>Sigma-Aldrich</td>
			<td>C4116</td>
			<td>0.2&mu;M</td>
		</tr>
		<tr>
			<td>All-Trans Retinoic Acid</td>
			<td>Sigma-Aldrich</td>
			<td>R2625</td>
			<td>2&mu;M</td>
		</tr>
		<tr>
			<td>DAPT</td>
			<td>Sigma-Aldrich</td>
			<td>D5942</td>
			<td>30&mu;M</td>
		</tr>
		<tr>
			<td>Nicotinamide</td>
			<td>Sigma-Aldrich</td>
			<td>N0636</td>
			<td>10 mM</td>
		</tr>
		<tr>
			<td>Sodium Selenite</td>
			<td>Sigma-Aldrich</td>
			<td>S5261</td>
			<td>30 nM</td>
		</tr>
		<tr>
			<td>Insulin</td>
			<td>Sigma-Aldrich</td>
			<td>I1882</td>
			<td>25 &mu;g/ml</td>
		</tr>
		<tr>
			<td>Transferrin</td>
			<td>Sigma-Aldrich</td>
			<td>T8158</td>
			<td>50 &mu;g/ml</td>
		</tr>
		<tr>
			<td>EGF</td>
			<td>R&amp;D</td>
			<td><a href="http://www.rndsystems.com/pdf/236-eg.pdf">236-EG</a></td>
			<td>10ng/ml</td>
		</tr>
		<tr>
			<td>EndoGro</td>
			<td>VEC Technologies</td>
			<td>ENDOGRO</td>
			<td>10mg</td>
		</tr>
		<tr>
			<td>Heparin</td>
			<td>Sigma-Aldrich</td>
			<td>H3149</td>
			<td>90&mu;g/ml</td>
		</tr>
		<tr>
			<td>Hydrocortisone</td>
			<td>Sigma-Aldrich</td>
			<td>H0888</td>
			<td>1&mu;g/ml</td>
		</tr>
		<tr>
			<td>NucleoSpin RNA II</td>
			<td>Macherey Nagel</td>
			<td>740955</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>ImProm II reverse transcription System</td>
			<td>Promega</td>
			<td>A3800</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Brilliant II SYBR Green QPCR master mix</td>
			<td>Straragene</td>
			<td>600548</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Sox17 goat polyclonal IgG</td>
			<td>Santa Cruz</td>
			<td>sc-17355</td>
			<td>1/500</td>
		</tr>
		<tr>
			<td>PDX1 goat polyclonal IgG</td>
			<td>Santa Cruz</td>
			<td>sc-14662</td>
			<td>1/500</td>
		</tr>
		<tr>
			<td>C-Peptide Rabbit polyclonal</td>
			<td>Cell Signaling</td>
			<td>4593</td>
			<td>1/500</td>
		</tr>
		<tr>
			<td>Alexa Fluor 488 donkey anti-rabbit IgG</td>
			<td>Invitrogen</td>
			<td>A-21206</td>
			<td>1/1000</td>
		</tr>
		<tr>
			<td>Alexa Fluor 647 donkey anti-goat IgG</td>
			<td>Invitrogen</td>
			<td>A-21447</td>
			<td>1/1000</td>
		</tr>
	</tbody>
</table>
Table 2. Reagents and Kits.

endothelial cell co-culture mediates maturation of human embryonic stem cell to pancreatic insulin producing cells in a directed differentiation approach

Embryonic stem cells (ESC) have two main characteristics: they can be indefinitely propagated in vitro in an undifferentiated state and they are pluripotent, thus having the potential to differentiate into multiple lineages. Such properties make ESCs extremely attractive for cell based therapy and regenerative treatment applications 1. However for its full potential to be realized the cells have to be differentiated into mature and functional phenotypes, which is a daunting task. A promising approach in inducing cellular differentiation is to closely mimic the path of organogenesis in the in vitro setting. Pancreatic development is known to occur in specific stages 2, starting with endoderm, which can develop into several organs, including liver and pancreas. Endoderm induction can be achieved by modulation of the nodal pathway through addition of Activin A 3 in combination with several growth factors 4-7. Definitive endoderm cells then undergo pancreatic commitment by inhibition of sonic hedgehog inhibition, which can be achieved in vitro by addition of cyclopamine 8. Pancreatic maturation is mediated by several parallel events including inhibition of notch signaling; aggregation of pancreatic progenitors into 3-dimentional clusters; induction of vascularization; to name a few. By far the most successful in vitro maturation of ESC derived pancreatic progenitor cells have been achieved through inhibition of notch signaling by DAPT supplementation 9. Although successful, this results in low yield of the mature phenotype with reduced functionality. A less studied area is the effect of endothelial cell signaling in pancreatic maturation, which is increasingly being appreciated as an important contributing factor in in-vivo pancreatic islet maturation 10,11.
The current study explores such effect of endothelial cell signaling in maturation of human ESC derived pancreatic progenitor cells into insulin producing islet-like cells. We report a multi-stage directed differentiation protocol where the human ESCs are first induced towards endoderm by Activin A along with inhibition of PI3K pathway. Pancreatic specification of endoderm cells is achieved by inhibition of sonic hedgehog signaling by Cyclopamine along with retinoid induction by addition of Retinoic Acid. The final stage of maturation is induced by endothelial cell signaling achieved by a co-culture configuration. While several endothelial cells have been tested in the co-culture, herein we present our data with rat heart microvascular endothelial Cells (RHMVEC), primarily for the ease of analysis.

Watch this Scientific Journal Video about Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach at J

Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

The current study describes a directed differentiation approach in inducing pancreatic differentiation of human embryonic stem cells. Of great significance is the finding that endothelial cell co-culture mediates maturation of human embryonic stem cell derived pancreatic progenitors into insulin expressing cells.

Embryonic stem cells (ESC) have two main characteristics: they can be indefinitely propagated in vitro in an undifferentiated state and they are ...

endothelial-cell-co-culture-mediates-maturation-human-embryonic-stem

Research

JoVE Journal

Biology

16.2K vues.  University of Pittsburgh. La présente étude décrit une approche différenciation dirigée dans l'induction de la différenciation du pancréas de cellules souches embryonnaires humaines. D'une grande importance est le fait que des cellules endothéliales de co-culture de maturation de la médiation sur les cellules souches embryonnaires humaines dérivées des progéniteurs pancréatiques en cellules exprimant l'insuline.

Vidéo: Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

Derivation of Hematopoietic Stem Cells from Murine Embryonic Stem Cells

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are derived from the blastocyst of the early embryo and are pluripotent in differentiative ability.  Their vast differentiative potential has made them the focus of much research centered on deducing how to coax them to generate clinically useful cell types.  The successful derivation of hematopoietic stem cells (HSC) from mouse ESC has recently been accomplished and can be visualized in this video protocol.  HSC, arguably the most clinically exploited cell population, are used to treat a myriad of hematopoietic malignancies and disorders.  However, many patients that might benefit from HSC therapy lack access to suitable donors.  ESC could provide an alternative source of HSC for these patients.  The following protocol establishes a baseline from which ESC-HSC can be studied and inform efforts to isolate HSC from human ESC.  In this protocol, ESC are differentiated as embryoid bodies (EBs) for 6 days in commercially available serum pre-screened for optimal hematopoietic differentiation.  EBs are then dissociated and infected with retroviral HoxB4.  Infected EB-derived cells are plated on OP9 stroma, a bone marrow stromal cell line derived from the calvaria of  M-CSF-/- mice, and co-cultured in the presence of hematopoiesis promoting cytokines for ten days.  During this co-culture, the infected cells expand greatly, resulting in the generation a heterogeneous pool of 100s of millions of cells.  These cells can then be used to rescue and reconstitute lethally irradiated mice.

This protocol details the derivation of transplantable hematopoietic stem cells from mouse embryonic stem cells (ESC) and their subsequent injection into lethally irradiated recipient mice. Briefly, ESC are differentiated as embryoid bodies, which are then infected with retroviral HoxB4 and co-cultured with OP9 stromal cells and hematopoietic cytokines.

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are ...

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Embryonic Stem Cell-Derived Endothelial Cells for Treatment of Hindlimb Ischemia

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This pathology causes symptoms such as intermittent claudication (pain with walking), painful ischemic ulcerations, or even limb-threatening gangrene. It is generally believed that the vascular endothelium, a monolayer of endothelial cells that invests the luminal surface of all blood and lymphatic vessels, plays a dominant role in vascular homeostasis and vascular regeneration. As a result, stem cell-based regeneration of the endothelium may be a promising approach for treating PAD.In this video, we demonstrate the transplantation of embryonic stem cell (ESC)-derived endothelial cells for treatment of unilateral hindimb ischemia as a model of PAD, followed by non-invasive tracking of cell homing and survival by bioluminescence imaging. The specific materials and procedures for cell delivery and imaging will be described. This protocol follows another publication in describing the induction of hindlimb ischemia by Niiyama et al.1

The surgical procedure for delivery of embryonic stem cell-derived endothelial cells to the ischemic hindlimb is demonstrated, with non-invasive tracking by bioluminescence imaging.

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This ...

Isolation and Large Scale Expansion of Adult Human Endothelial Colony Forming Progenitor Cells

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult human peripheral blood within a mean of 12 days. After large scale expansion &gt;1x108 ECFCs can be obtained for further tests. Advantageously by using pHPL the contact of human cells with bovine serum antigens can be excluded. By flow cytometry and immunohistochemistry the isolated cells can be characterized as ECFC and their in vitro functionality to form vascular like structures can be tested in a matrigel assay. Further these cells can be subcutaneously injected in a mouse model to form functional, perfused vessels in vivo. After long term expansion and cryopreservation proliferation, function and genomic stability appear to be preserved. 3,4
This animal-protein free isolation and expansion method is easily applicable to generate a large quantity of ECFCs.

Endothelial colony forming progenitor cells (ECFCs) are a promising tool to study vascular homeostasis and repair.1,2 This paper introduces a novel animal-serum free method for isolation and expansion of ECFC from heparinised adult human peripheral blood with pooled human platelet lysate (pHPL) diminishing the risk of anti-bovine immunisation.

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult ...

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells (MSCs) and Endothelial Colony Forming Progenitor Cells (ECFCs)

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal stem cells, MSCs) and endothelial colony forming progenitor cells (ECFCs). Both cell types are key players in maintaining the integrity of tissue and are probably also involved in regenerative processes and tumor formation.
To study their biology and function in a comparative manner it is important to have both cells types available from the same donor. It may also be beneficial for regenerative purposes to derive MSCs and ECFCs from the same tissue.
Because cellular therapeutics should eventually find their way from bench to bedside we established a new method to isolate and further expand progenitor cells without the use of animal protein. Pooled human platelet lysate (pHPL) replaced fetal bovine serum in all steps of our protocol to completely avoid contact of the cells to xenogeneic proteins.
This video demonstrates a methodology for the isolation and expansion of progenitor cells from one umbilical cord.
All materials and procedures will be described.

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells MSCs and Endothelial Colony Forming Progenitor Cells ECFCs

This protocol describes the isolation and subsequent expansion of mesenchymal stromal cells and endothelial colony forming cells without the use of animal serum to generate autologous pairs for experimental transplantation purposes.

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal ...

Video Bioinformatics Analysis of Human Embryonic Stem Cell Colony Growth

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer software.  Video bioinformatics is a powerful quantitative approach for extracting spatio-temporal data from video images using computer software to perform dating mining and analysis. In this article, we introduce a video bioinformatics method for quantifying the growth of human embryonic stem cells (hESC) by analyzing time-lapse videos collected in a Nikon BioStation CT incubator equipped with a camera for video imaging. In our experiments, hESC colonies that were attached to Matrigel were filmed for 48 hours in the BioStation CT.  To determine the rate of growth of these colonies, recipes were developed using CL-Quant software which enables users to extract various types of data from video images.  To accurately evaluate colony growth, three recipes were created. The first segmented the image into the colony and background, the second enhanced the image to define colonies throughout the video sequence accurately, and the third measured the number of pixels in the colony over time.  The three recipes were run in sequence on video data collected in a BioStation CT to analyze the rate of growth of individual hESC colonies over 48 hours. To verify the truthfulness of the CL-Quant recipes, the same data were analyzed manually using Adobe Photoshop software. When the data obtained using the CL-Quant recipes and Photoshop were compared, results were virtually identical, indicating the CL-Quant recipes were truthful. The method described here could be applied to any video data to measure growth rates of hESC or other cells that grow in colonies. In addition, other video bioinformatics recipes can be developed in the future for other cell processes such as migration, apoptosis, and cell adhesion.  

Video bioinformatics is the automated processing, analysis, understanding, and data mining of biological spatio-temporal data extracted from microscopic videos. The purpose of this article is to demonstrate a method for measuring human embryonic stem cell colony growth using a video bioinformatics method.

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three ...

Efficient Derivation of Human Cardiac Precursors and Cardiomyocytes from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based transplantation or by cardiac tissue engineering1-3. Cardiomyocytes become terminally-differentiated soon after birth and lose their ability to proliferate. There is no evidence that stem/progenitor cells derived from other sources, such as the bone marrow or the cord blood, are able to give rise to the contractile heart muscle cells following transplantation into the heart1-3. The need to regenerate or repair the damaged heart muscle has not been met by adult stem cell therapy, either endogenous or via cell delivery1-3. The genetically stable human embryonic stem cells (hESCs) have unlimited expansion ability and unrestricted plasticity, proffering a pluripotent reservoir for in vitro derivation of large supplies of human somatic cells that are restricted to the lineage in need of repair and regeneration4,5. Due to the prevalence of cardiovascular disease worldwide and acute shortage of donor organs, there is intense interest in developing hESC-based therapies as an alternative approach. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity6-8 (see a schematic in Fig. 1A). In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic9-11. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules12 (see a schematic in Fig. 1B). After screening a variety of small molecules and growth factors, we found that such defined conditions rendered nicotinamide (NAM) sufficient to induce the specification of cardiomesoderm direct from pluripotent hESCs that further progressed to cardioblasts that generated human beating cardiomyocytes with high efficiency (Fig. 2). We defined conditions for induction of cardioblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human cardiac cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of cardioblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human cardiac progenitors and functional cardiomyocytes for cardiovascular repair.

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based ...

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells (iPSCs) Using Retroviral Vector with GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has been previously shown that human somatic cells can be reprogrammed to pluripotency by ectopic expression of four transcription factors (Oct4, Sox2, Klf4 and Myc) and become induced pluripotent stem cells (iPSCs)2-4 . Like hESCs, human iPSCs are pluripotent and a potential source for autologous cells. Here we describe the protocol to reprogram human fibroblast cells with the four reprogramming factors cloned into GFP-containing retroviral backbone4. Using the following protocol, we generate human iPSCs in 3-4 weeks under human ESC culture condition. Human iPSC colonies closely resemble hESCs in morphology and display the loss of GFP fluorescence as a result of retroviral transgene silencing. iPSC colonies isolated mechanically under a fluorescence microscope behave in a similar fashion as hESCs. In these cells, we detect the expression of multiple pluripotency genes and surface markers.

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells iPSCs Using Retroviral Vector with GFP

A method to generate human induced pluripotent stem cells (iPSCs) via retrovirus-mediated ectopic expression of OCT4, SOX2, KLF4 and MYC is described. A practical way to identify human iPSC colonies based on GFP expression is also discussed.

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has ...