Retroviral CRISPR/Cas9-Mediated Gene Targeting for the Study of Th17 Differentiation in Vitro

Summary

We present a protocol for retroviral transduction of guide RNA into primary T cells from Cas9 transgenic mice, providing an efficient alternative for gene editing in studying Th17 differentiation.

Abstract

T helper cells that produce IL-17A, known as Th17 cells, play a critical role in immune defense and are implicated in autoimmune disorders. CD4 T cells can be stimulated with antigens and well-defined cytokine cocktails in vitro to mimic Th17 cell differentiation in vivo. Research has been conducted extensively on the Th17 differentiation regulation mechanisms using the in vitro Th17 polarization assay.

Conventional Th17 polarization methods typically involve obtaining naïve CD4 T cells from genetically modified mice to study the effects of specific genes on Th17 differentiation and function. These methods can be time-consuming and costly and may be influenced by cell-extrinsic factors from the knockout animals. Thus, a protocol using retroviral transduction of guide RNA to introduce gene knockout in CRISPR/Cas9 knockin primary mouse T cells serves as a very useful alternative approach. This paper presents a protocol to differentiate naïve primary T cells into Th17 cells following retroviral-mediated gene targeting, as well as the subsequent flow cytometry analysis methods for assaying infection and differentiation efficiency.

Introduction

Th17 cells, a unique subset of CD4⁺ T helper cells, are vital for eradicating extracellular bacteria and fungi and play a significant role in various autoimmune diseases^1,2,3. Emerging evidence suggests that Th17 cells exhibit heterogeneity, functioning in both pathogenic and non-pathogenic conditions, influenced by environmental and genetic factors. Elucidating the regulatory processes that control the differentiation of Th17 cells, plasticity, and heterogeneity is crucial for the advancement of more effective immunotherapeutic strategies.

Genetically modified animals have been widely used to unveil the key regulators of Th17 cell differentiation and functions. Using genetically modified animals involves complete manipulation in vivo, providing authenticity and systematic study of its role in physiological conditions or disease models. Nevertheless, high-throughput screening with this approach is largely impractical. In vitro polarization assays provide an alternative for studying Th17 cell differentiation. Interleukin 6 (IL-6) in combination with transforming growth factor β1 (TGFβ1) has been shown to promote the development of non-pathogenic Th17 cells, while IL-6, IL-1β, and IL-23 are implicated in driving the differentiation of pathogenic Th17 cells (pTh17)^4,5.

The emergence of CRISPR/Cas9 technology has facilitated precise genome editing at specific bases. When combined with retroviral transduction, this approach provides a potent, efficient, and economical genetic method for screening and functionally studying potential regulators in Th17 cells^6,7. In this study, we improved the procedure for retroviral transduction within Th17 polarization system. Using a retroviral system, we infected pre-established Cas9-expressing activated naïve T cells from mice. The cells were transduced with guide RNA (gRNA) constructs driven by the U6 promoter, along with genes encoding fluorescent reporter proteins under the control of the EF1a promoter to facilitate the knockout of the target gene. Then, the transduced T cells were cultured under specific cytokine conditions to induce differentiation into Th17 cells. Notably, knocking out RoRγt significantly reduced IL-17A production compared to the control group. The effectiveness of this system depends on optimized retrovirus production and transduction conditions for activated primary T cells, providing a rapid and practical approach for studying specific genes in Th17 differentiation and function.

Protocol

​All procedures were approved by the Experimental Animal Welfare Ethics Committee, Renji Hospital, Shanghai Jiao Tong University School of Medicine and are in compliance with institutional guidelines.

1. Retroviral production

1.  Preparation of retroviral construct
   1. Use the CRISPick tool (https://portals.broadinstitute.org/gppx/crispick/public) to design the sgRNA for RORγt knockout⁸. Specify the reference genome as Mouse GRCm38, and choose the PAM sequence as NGG (for SpyoCas9, Hsu (2013) tracrRNA) based on CRISPRko guide system. Validate the target gene's name or other target gene formats and submit the valid input to obtain sgRNA candidates. Setting other parameters to default values, set sgRNA target to RORγt (Rorc, Gene ID: 19885) to disturb the differentiation of Th17 and select non-targeting sgRNA (abbr. sgNT, sequence: GCGAGGTATTCGGCTCCGCG) from the mouse GeCKO v2 libraries.
      NOTE: This tool offers a range of clickable options for designing guide RNAs, allowing for convenient customization to meet specific requirements.
      1. Enter the target gene name in the search box under the Quick Gene Lookup column. The system will display the gene ID and the full name of the target gene to ensure accurate selection.
         NOTE: Additional options are available for validating different target gene formats.
   2. Choose one sgRNA targeted on Rorc (abbr. sgRorc) sequence according to the high combined rank and pick order to avoid off-target matches and increase on-target efficacy (sgRorc sequence: GTCATCTGGGATCCACTACG). Synthesize two oligonucleotides for sgRorc and sgNT: for the forward oligo, append the sequence "gttttagagctagaaatagcaagttaaaat" to the 5' end of each guide sequence; for the reverse oligo, append the sequence "tttcgtcctttccacaagatatataaagc" to the 3' end of each guide sequence.
      NOTE: Typically, multiple options exist for sgRNA sequences. It is essential to select 2 or 3 sgRNA sequences targeting the same genotype to assess their knockout efficiency. In our preliminary experiments, two gRNAs target to Rorc were selected for comparison (sgRNA sequence1: GTCATCTGGGATCCACTACG; sgRNA sequence2: CTTGAGTATAGTCCAGAACG). Experimental results indicated that the gRNA presented in the current method (sgRNA sequence1) exhibits higher knockout efficiency between the two.
   3. Amplify the sgRorc and sgNT coding sequences using DNA polymerase in PCR with the above primers and clone them into pMX-U6-MCS vector (between the regions of U6 promoter and the gRNA scaffold) in frame with mCherry fluorescent protein, respectively⁹. Set up the reaction system (50 µL) as Table 1. Those primers consist of sgRNA sequence (3'), which can insert the sgRNA into the vector, and a segment of vector sequence (5'), which can amplify the full-length vector fragment. Additionally, design the forward and reverse primers with an overlap of approximately 18 bp within the sgRNA region (but not fully overlapping), facilitating the assembly of the linearized cloning vector during the ligation process.
      NOTE: A linearized vector fragment at the site of sgRNA sequence with primers by PCR of approximately 5,551 kd should be obtained.
   4. Purify the construct using a gel extraction kit and circularize it using a cloning kit. Use the recombination products for transformation assays.
   5. Pick the single clones from plates and verify sgRorc or sgNT-coding sequences via first-generation sequencing, using U6 promoter primer (sequence: ATGGACTATCATATGCTTACCGTA).
   6. Select the desired single clone for amplification in the LB broth. Extract high-quality plasmid DNA from bacterial cells by using an endotoxin-free plasmid kit.
      NOTE: Make sure that plasmid solution has a high quality. We recommend that the concentration of plasmid solution should be at least 1 µg/µL.
2. Preparation of packaging cells
   1. Prepare Platinum-E (Plat-E) cells using the following procedure: culture Plat-E cells with Dulbecco's Modified Eagle's Medium (DMEM medium) containing 10% fetal bovine serum (FBS), 100 units/mL penicillin, and 0.1 mg/mL streptomycin in a 10 cm culture dish. It will be referred to as the cell culture medium in the following.
      NOTE: To obtain the proper transfection efficiency, we recommend using cells in the logarithmic growth phase with less than 15 passage numbers.
   2. Split a full plate of 10 cm Plat-E cells (~2.6 × 10⁷ cells) at a proper ratio into a new 10 cm dish 1 day before transfection to achieve a cell confluency of approximately 80% the next day, which is the optimal condition for transfection. Perform cell passaging for a new 10 cm dish at a 1:3 ratio (seed ~8 × 10⁶ cells in a new 10 cm dish the day before transfection).
      NOTE: The split ratio is contingent upon the growth condition of the cells, with higher transfection efficiency achievable in cells exhibiting robust growth. We perform cell passaging for a 10 cm dish at a 1:3 ratio. For different cell culture dishes, such as a 6 cm dish, we recommend that 1.5 × 10⁶ Plat-E cells should be seeded the day before transfection.
3. Transfection
   1. One hour before transfection, substitute the cell culture medium with 8 mL of reduced serum medium without phenol red with 5% FBS, but without penicillin-streptomycin, as it may interfere with the transfection reagent. Warm the reduced serum medium to 37 °C before use.
   2. Prepare the transfection mixture containing mix 1 and mix 2: mix 1 includes 18 µg of plasmid DNA (pMXs-U6-MCS-sgNT-mCherry/pMXs-U6-MCS-sgRorc-mCherry) and 6 µg of pCL-Ecotropic Retroviral Vector (pCL-Eco) in 1,000 µL of reduced serum medium. Mix 2 contains 48 µL of transfection reagent in 1,000 µL of reduced serum medium. Add mix 2 drop by drop into mix 1 and mix gently and thoroughly. Incubate the complex for 15-20 min at 20-25 °C.
   3. Carefully drip the mixture into the Plat-E cells, swirling the plate gently to ensure even distribution. Incubate the cells at 37 °C under 5% CO₂ for 6-12 h.
   4. Replace the medium with 10 mL of fresh cell culture medium and continue incubating the cells at 37 °C, 5% CO₂ for 48 h.
   5. Assess the transfection efficiency in Plat-E cells by detecting the retroviral vector tag, serving as a proxy, via fluorescence microscopy or flow cytometry.
      NOTE: A strong mCherry fluorescence (the fluorescence positive exceeds 80%) signal was detected in a considerable proportion of Plat-E cells transfected with the pMX-U6-MCS vector, indicating successful transfection.
   6. Harvest the virus-containing culture supernatant and centrifuge at 1,500 × g for 10 min to remove cell fragments. Aliquot the virus supernatant 1 mL per vial and store at -80 °C.
      NOTE: Filtration is an alternative method for removing cell debris. We recommend using a syringe filter with a 0.45 µm pore size and a polyethersulfone (PES) membrane to minimize the retention of viral particles on the filter membrane.

2. Retroviral infection of activated CD4 ⁺ T cells and Th17 differentiation

1. Prepare and activate primary naïve CD4⁺ T cells
   1. Coat each well of a 24-well cell culture plate with 2 µg/mL of anti-CD3e and 4 µg/mL of anti-CD28 in sterile 500 µL PBS, wrap the plate in parafilm to prevent evaporation and contamination, and then incubate plate at 4 °C overnight (or 37 °C for 1-2 hours before plating CD4⁺ T cells) at the day before isolating naïve CD4⁺ T cells.
      NOTE: This step is needed to perform plate-bound stimulation for the mouse T cells before performing viral transduction.
   2. On the next day, euthanize 6-8-week-old Cas9-expressing mice (R26-CAG-Cas9 mice) by CO₂ asphyxiation and sterilize them with 70% ethanol.
   3. Harvest the mouse spleen and place it in PBS with 2% FBS and 100 µM EDTA (FACS buffer).
   4. Grind the spleen with sterilized ground glass (matte side) in the FACS buffer, homogenize the tissue into a single-cell suspension, and filter the cell suspension through a 70 µm cell strainer into a 50 mL tube.
      NOTE: Be sure to grind the tissue gently and consistently to keep the tissue moist. Violently grinding the tissue can affect cell survival dramatically.
   5. Spin the splenic cell suspension at 800 × g for 5 min. Remove the supernatant and resuspend the cell pellet in 2 mL of red cell lysis buffer. Let it sit at room temperature for 5 min, then add FACS buffer to reach a total volume of 15 mL. Centrifuge the splenocytes at 800 × g for 5 min.
   6. Resuspend the splenocytes and filter them through a 40 µm cell strainer. Adjust the final volume to 1 mL for the CD4⁺ T cell isolation.
   7. Isolate CD4⁺ T cells using commercial reagent kits by following the instructions in the manual.
   8. Label the CD4⁺ T cells with fluorescent antibodies mixture (CD4, CD25, CD44, and CD62L) at 4 °C for 30 min, wash the cells with FACS buffer, and isolate the naïve CD4⁺ T cells using a flow cell sorter. This will result in obtaining CD4⁺CD25^-CD62L^highCD44^low naïve T cells.
   9. Remove the plate-bound stimulation supernatant from the 24-well cell culture plate (prepared in step 2.1.1) and rinse each well twice with 500 µL of PBS. Plate 1 x 10⁶ naïve CD4⁺ T cells in 1 mL of lymphocyte culture medium in a well of the 24-well cell culture plate. Incubate the cells in the cell incubator.
      NOTE: Lymphocyte culture medium contains 10% FBS, 100 units/mL penicillin, and 0.1 mg/mL streptomycin, 1 mM sodium pyruvate, 10 mM HEPES, and 50 µM β-ME in RPMI 1640 medium.
2. Retroviral infection
   1. After 18-24 h, collect each well of activated cells into the 1.5 mL tube. Centrifuge at 800 × g for 5 min, and discard the supernatant.
   2. Resuspend the cell pellet in 1 mL of infection mixture (10 µg/mL hexadimethrine bromide, 10 mM HEPES in virus supernatant) and add 1 mL of the mixture to a new well of a 48-well cell culture plate. In the meanwhile, save enough cells as negative (un-transduced) control.
      NOTE: It is feasible to have fewer than 1 x 10⁶ activated naïve CD4⁺ T cells per well, but it is not recommended to use less than 0.5 x 10⁶ cells per well. Additionally, no cells should be seeded in the peripheral wells of the 48-well culture plate.
   3. Wrap the plate with parafilm, and centrifuge at 800 x g for 90 min at 32 °C. Set accelerate and decelerate at 3. After centrifugation, remove the parafilm, incubate the cells in the incubator for 4 h, and proceed with the differentiation steps.
3. Differentiation of infected cells into Th17 cells
   1. Prepare the antigen-presenting cells (APC) during retroviral infection. First, obtain splenocytes from wild-type mice following the instructions from steps 2.1.2 to 2.1.4. Resuspend the splenocytes with 1 mL of lymphocyte culture medium with 50 µg/mL mitomycin in a 15 mL tube. Incubate the splenocytes at 37 °C under 5% CO₂ for 1 h.
   2. One hour later, add PBS up to the 15 mL mark to wash the splenocytes, centrifuge at 800 x g for 5 min, discard the supernatant, resuspend the splenocytes with 1 mL of lymphocyte culture medium, and count the cell number. APC cells have been successfully prepared.
   3. After the 4 h of cell incubation (as in step 2.2.3), collect transduced CD4⁺ T cells in 1.5 mL tubes and centrifuge at 800 x g for 5 min. Discard the supernatant and resuspend infected cells in 600 µL of PBS to wash. Centrifuge at 800 x g for 5 min and discard the supernatant.
   4. Place 0.5 × 10⁶ transduced CD4⁺ T cells in 1 mL of lymphocyte culture medium with 1.5 x 10⁶ APC cells in a well of a 24-well cell culture plate. Supplement with 2 µg/mL of anti-CD3e, 2 µg/mL of anti-CD28, and Th17 cell differentiation cocktail, which contains 10 µg/mL anti-IFNγ, 10 µg/mL anti-IL-12/IL23 p40, 10 µg/mL anti-IL4, 2.5-3 ng/mL hTGF-β, and 20-30 ng/mL IL-6. Culture cells for 2 days.
   5. Collect each well of cells into the 1.5 mL tubes, centrifuge at 800 x g for 5 min, and discard the supernatant. Refresh new 1 mL of the lymphocyte culture medium only with 3 ng/mL TGF-β and 30 ng/mL IL-6. Place the cells in a new well of 24-well cell culture plate for an extended culture period. Analyze the cells 2 days after the medium change.

3. Evaluation of transduction efficiency and differentiation results

1. After two days of medium change, collect cells and centrifuge at 800 × g for 5 min and discard the supernatant. Treat differentiated cells with 50 ng/mL phorbol 12-myristate 13-acetate (PMA), 500 ng/mL ionomycin and 5 µg/mL brefeldin A in 500 µL of lymphocyte culture medium in a new well of 24-well cell culture plate at 37 °C incubator for 4 h. Harvest half of the cells for flow cytometry analysis and lyse the other half of the cells with RNA extraction buffer for qPCR analysis.
2. For flow cytometry analysis
   1. Collect the cells into 1.5 mL tubes. Add 1 mL of FACS buffer into tubes and centrifuge at 800 × g for 5 min to wash the cells.
   2. Resuspend the cell pellet with fluorescent antibodies mixture (CD4 and Fixable Viability Dye in 100 µL of PBS) and stain the cells at 4 °C for 30 min.
   3. Wash the cells with 300 µL of PBS and fix them with 300 µL of 2% phosphate-buffered formaldehyde (FA) at 4 °C for at least 60 min.
   4. One hour later, wash the cells with PBS, resuspend them with 600 µL of 1x permeabilization buffer, and centrifuge at 800 × g for 5 min.
   5. Discard the supernatant and stain with anti-IL-17A in 100 µL of 1x permeabilization buffer for 60 min at room temperature or 4 °C overnight.
   6. The next day, wash the cells with 1x permeabilization buffer and resuspend them in 200 µL of PBS. Analyze the cells by flow cytometry¹⁰. See the Representative Results section.
3. For qPCR analysis, extract RNA following the instructions of the RNA extraction kit. Reverse-transcribe the RNA into cDNA for storage or subsequent qPCR analysis. The design of these primers should adhere to general qPCR primer design principles while also specifically targeting the region spanning the expected indel site, where gRNA-mediated cleavage has occurred. Any reduction in amplification efficiency or loss of signal at this site may serve as an indicator of successful knockout. The qPCR primers are as follows:
   Rorc F: TCCACTACGGGGTTATCACCT; R: AGTAGGCCACATTACACTGCT.
   IL17a F: TCAGCGTGTCCAAACACTGAG; R: CGCCAAGGGAGTTAAAGACTT.

Results

In the study, we cloned the sgRNA target to Rorc and sgRNA-non-targeting coding sequences into pMX-U6-MCS vector with mCherry fluorescent protein (Figure 1A,B). Retrovirus production was carried out according to the protocol outlined in Figure 2. The transfection was initiated on day 0, and the retroviral harvest occurred on day 2. Transfection efficiency can be tested by the mCherry fluorescence intensi...

Discussion

CRISPR/Cas9 genome editing via retroviral delivery is a robust method for exploring the roles of helper T cells. This protocol offers a rapid and effective approach to examining specific genes involved in Th17 differentiation and function. Several critical steps must be carefully followed to achieve optimal results. First, for enhanced gene knockout efficiency, gRNAs should be carefully selected. Given the risk of off-target effects in CRISPR/Cas9 gene editing, it is prudent to choose 2-3 gRNAs with high scores, as ident...

Materials

Name	Company	Catalog Number	Comments
0.5 M EDTA (pH 8.0)	Solarbio	E1170
100 mm cell and tissue Culture Dish	BIOFIL	TCD010100
1 M Hepes (Free Acid, sterile)	Solarbio	H1090
24-well cell and tissue culture plate	NEST	702002
48-well cell and tissue culture plate	NEST	748002
Brefeldin A Solution (1,000x)	BioLegend	420601
Brilliant Violet 650 anti-mouse CD4 Antibody (RM4-5)	BioLegend	100546
CD3e Monoclonal Antibody (145-2C11), Functional Grade, eBioscience	Invitrogen	16-0031-82
CD44 Monoclonal Antibody (IM7), PE, eBioscience	Invitrogen	12-0441-83
CD62L (L-Selectin) Monoclonal Antibody (MEL-14), APC, eBioscience	Invitrogen	17-0621-82
Cell counter	Nexcelom Bioscience	Cellometer Auto 2000
Cell Strainer (40 μm)	biosharp	BS-40-CS
Cell Strainer (70 μm)	biosharp	BS-70-CS
Centrifuge	eppendorf	5425 R
Centrifuge	eppendorf	5810 R
ChamQ SYBR Color qPCR Master Mix	Vazyme	Q411-02
ClonExpress II One Step Cloning Kit	Vazyme	C112
DH5α Competent Cells	Sangon Biotech	B528413
Direct-zol RNA Miniprep	ZYMO RESEARCH	R2050
DMEM Medium	BasalMedia	L110KJ
EasySep Mouse CD4+ T Cell Isolation Kit	STEMCELL	19852
eBioscience Fixable Viability Dye eFluor 660	Invitrogen	65-0864-18
EndoFree Mini Plasmid Kit II	TIANGEN	DP118-02
ExFect Transfection Reagent	Vazyme	T101-01
Fetal Bovine Serum, Premium Plus	Gibco	A5669701
FITC anti-mouse IL-17A Antibody (TC11-18H10.1)	BioLegend	506907
Formaldehyde solution	Macklin	F864792
HiScript IV RT SuperMix for qPCR（+gDNA wiper）	Vazyme	R423-01
Ionomycin	Beyotime	S1672
Mitomycin C	Maokang Biotechnology	7/7/1950
Mouse GRCm38	NCBI	RefSeq v.108.20200622
OPTI-MEM Reduced Serum Medium	Gibco	31985070	reduced serum medium
Pacific Blue anti-mouse CD4 Antibody (RM4-5)	BioLegend	100531
PE/Cyanine7 anti-mouse CD25 Antibody (PC61)	BioLegend	102015
PE/Cyanine7 anti-mouse CD4 Antibody (GK1.5)	BioLegend	100422
Penicillin-Streptomycin (10,000 U/mL)	Gibco	15140122
PMA/TPA	Beyotime	S1819
R26-CAG-Cas9 mice	Shanghai Model Organisms Center	Cat. NO. NM-KI-00120
Recombinant Human TGF-beta 1 (CHO-Expressed) Protein, CF	R&D Systems	11409-BH
Recombinant Murine IL-6	PeproTech	216-16
Research Cell Analyzer	BD Biosciences	BD LSRFortessa
Research Cell Sorter	SONY	MA900
RPMI 1640 Medium	BasalMedia	L210KJ
SimpliAmp Thermal Cycler PCR System	Applied Biosystems	A24811
Sodium pyruvate solution (100 mM)	Sigma-Aldrich	S8636
Ultra-LEAF Purified anti-mouse CD28 Antibody (37.51)	BioLegend	102121
Ultra-LEAF Purified anti-mouse IFN-γ Antibody (XMG1.2)	BioLegend	505847
Ultra-LEAF Purified anti-mouse IL-4 Antibody (11B11)	BioLegend	504135
Ultra-LEAF Purified anti-mouse IL-12/IL-23 p40 Antibody (C17.8)	BioLegend	505309
β-Mercaptoethanol (50 mM)	Solarbio	M8211