We would like to thank Monika Tarnowska, Cornelia Albrecht, and Ewa Skoczylas for excellent technical assistance. This study was funded by SNF Sinergia grant CRSI33-125073 to PP.

<ol>
	<li>Capecchi, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+in+mice:+functional+analysis+of+the+mammalian+genome+for+the+twenty-first+century.">Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century.</a> Nat. Rev. Genetics. 6, 507-512 (2005).</li><li>Johansson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Building+a+zoo+of+mice+for+genetic+analyses:+a+comprehensive+protocol+for+the+rapid+generation+of+BAC+transgenic+mice.">Building a zoo of mice for genetic analyses: a comprehensive protocol for the rapid generation of BAC transgenic mice.</a> Genesis. 48, 264-280 (2010).</li><li>Skarnes, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+knockout+resource+for+the+genome-wide+study+of+mouse+gene+function.">A conditional knockout resource for the genome-wide study of mouse gene function.</a> Nature. 474, 337-342 (2011).</li><li>Carbery, I. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modification+in+mice+using+zinc-finger+nucleases.">Targeted genome modification in mice using zinc-finger nucleases.</a> Genetics. 186, 451-459 (2010).</li><li>Meyer, M., de Angelis, M. H., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+by+homologous+recombination+in+mouse+zygotes+mediated+by+zinc-finger+nucleases.">Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 15022-15026 (2010).</li><li>Cui, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+integration+in+rat+and+mouse+embryos+with+zinc-finger+nucleases.">Targeted integration in rat and mouse embryos with zinc-finger nucleases.</a> Nat. Biotechnol. 29, 64-67 (2011).</li><li>Sung, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knockout+mice+created+by+TALEN-mediated+gene+targeting.">Knockout mice created by TALEN-mediated gene targeting.</a> Nat. Biotechnol. 31, 23-24 (2013).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+production+of+mouse+disease+models+by+embryo+microinjection+of+TALENs+and+oligodeoxynucleotides.">Direct production of mouse disease models by embryo microinjection of TALENs and oligodeoxynucleotides.</a> Proc. Natl. Acad. Sci. U.S.A. 110, 3782-3787 (2013).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-Step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/Cas-mediated+genome+engineering.">One-Step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.</a> Cell. 153, 910-918 (2013).</li><li>Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., Gregory, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+with+engineered+zinc+finger+nucleases.">Genome editing with engineered zinc finger nucleases.</a> Nat. Rev. Genetics. 11, 636-646 (2010).</li><li>ZFN, T. A. L. E. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas-based+methods+for+genome+engineering.">CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li><li>Joung, J. K., Sander, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TALENs:+a+widely+applicable+technology+for+targeted+genome+editing.">TALENs: a widely applicable technology for targeted genome editing.</a> Nat. Rev. Mol. Cell Biol. 14, 49-55 (2013).</li><li>Cermak, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+design+and+assembly+of+custom+TALEN+and+other+TAL+effector-based+constructs+for+DNA+targeting.">Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting.</a> Nucleic Acids Res. 39, (2011).</li><li>Reyon, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH+assembly+of+TALENs+for+high-throughput+genome+editing.">FLASH assembly of TALENs for high-throughput genome editing.</a> Nat. Biotechnol. 30, 460-465 (2012).</li><li>Sanjana, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcription+activator-like+effector+toolbox+for+genome+engineering.">A transcription activator-like effector toolbox for genome engineering.</a> Nat. Protoc. 7, 171-192 (2012).</li><li>Kim, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+library+of+TAL+effector+nucleases+spanning+the+human+genome.">A library of TAL effector nucleases spanning the human genome.</a> Nat. Biotechnol. 31, 251-258 (2013).</li><li>Schmid-Burgk, J. L., Schmidt, T., Kaiser, V., Honing, K., Hornung, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ligation-independent+cloning+technique+for+high-throughput+assembly+of+transcription+activator-like+effector+genes.">A ligation-independent cloning technique for high-throughput assembly of transcription activator-like effector genes.</a> Nat. Biotechnol. 31, 76-81 (2013).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nat. Biotechnol. 31, 827-832 (2013).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nat. Biotechnol. 31, 822-826 (2013).</li><li>Hermann, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+OPEN+zinc+finger+nucleases+for+direct+gene+targeting+of+the+ROSA26+locus+in+mouse+embryos.">Evaluation of OPEN zinc finger nucleases for direct gene targeting of the ROSA26 locus in mouse embryos.</a> PLoS ONE. 7, (2012).</li><li>Meyer, M., Ortiz, O., Hrabe de Angelis, M., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+disease+mutations+by+gene+targeting+in+one-cell+mouse+embryos.">Modeling disease mutations by gene targeting in one-cell mouse embryos.</a> Proc. Natl. Acad. Sci. U.S.A. 109, 9354-9359 (2012).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Miller, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TALE+nuclease+architecture+for+efficient+genome+editing.">A TALE nuclease architecture for efficient genome editing.</a> Nat. Biotechnol. 29, 143-148 (2011).</li><li>Guo, J., Gaj, T., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+an+enhanced+and+highly+efficient+FokI+cleavage+domain+for+zinc+finger+nucleases.">Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases.</a> J. Mol. Biol. 400, 96-107 (2010).</li><li>Doyon, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+zinc-finger-nuclease+activity+with+improved+obligate+heterodimeric+architectures.">Enhancing zinc-finger-nuclease activity with improved obligate heterodimeric architectures.</a> Nat. Methods. 8, 74-79 (2011).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Wefers, B., Wurst, W., K&#252;hn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Haueter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+vasectomy-overexpression+of+Prm1-EGFP+fusion+protein+in+elongating+spermatids+causes+dominant+male+sterility+in+mice.">Genetic vasectomy-overexpression of Prm1-EGFP fusion protein in elongating spermatids causes dominant male sterility in mice.</a> Genesis. 48, 151-160 (2010).</li><li>Perez-Pinera, P., Ousterout, D. G., Brown, M. T., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+to+the+ROSA26+locus+directed+by+engineered+zinc+finger+nucleases.">Gene targeting to the ROSA26 locus directed by engineered zinc finger nucleases.</a> Nucleic Acids Res. 40, 3741-3752 (2012).</li><li>Bultmann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+transcriptional+activation+of+silent+oct4+pluripotency+gene+by+combining+designer+TALEs+and+inhibition+of+epigenetic+modifiers.">Targeted transcriptional activation of silent oct4 pluripotency gene by combining designer TALEs and inhibition of epigenetic modifiers.</a> Nucleic Acids Res. 40, 5368-5377 (2012).</li><li>Valton, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+TALE+DNA+binding+domain+sensitivity+to+cytosine+methylation.">Overcoming TALE DNA binding domain sensitivity to cytosine methylation.</a> J. Biol. Chem. 287, 38427-38432 (2012).</li><li>Cradick, T. J., Ambrosini, G., Iseli, C., Bucher, P., McCaffrey, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN-Site+searches+genomes+for+zinc+finger+nuclease+target+sites+and+off-target+sites.">ZFN-Site searches genomes for zinc finger nuclease target sites and off-target sites.</a> BMC Bioinform. 12, (2011).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Byers, S. L., Payson, S. J., Taft, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+ten+inbred+mouse+strains+following+assisted+reproductive+technologies+(ARTs).">Performance of ten inbred mouse strains following assisted reproductive technologies (ARTs).</a> Theriogenology. 65, 1716-1726 (2006).</li><li>Luo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Superovulation+strategies+for+6+commonly+used+mouse+strains.">Superovulation strategies for 6 commonly used mouse strains.</a> J. Am. Assoc. Lab. Animal Sci. 50, 471-478 (2011).</li><li>Pease, S., Saunders, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> International Society for Transgenic Technologies. Advanced protocols for animal transgenesis : an ISTT manual. , (2011).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339, 819-823 (2013).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+human+genome+engineering+via+Cas9.">RNA-Guided human genome engineering via Cas9.</a> Science. 339, 823-826 (2013).</li></ol>

The authors declare no competing interests.

Designer nuclease-driven genome editing approaches have significantly extended the range of species amenable to targeted modifications of their respective genomes10,12. In mice, gene-targeting in ES cells has been a standard technique for over two decades; however, it has proven difficult to adapt to ES cells from species other than the mouse, although there has been some recent success in rat ES cells. Even with the availability of "off-the-shelf" gene-targeted mouse ES cell clones provided by consortia such as EUCOMM, KOMP, or NorCOMM3 genome editing by ZFN and TALEN provides higher precision and flexibility regarding the spectrum of modifications that can be introduced into the mouse genome. Founder animals carrying nuclease-mediated mutations seem to be highly germ-line competent4-6,20,21, which is not always the case for chimeras originating from blastocyst injections of ES cells. Thus, in certain cases microinjection of designer nucleases can result in significantly faster generation of novel mouse lines with targeted genome modifications.
The successful generation of knockout mice by injection of ZFN and TALEN depends to a great extent on the activity of the injected nuclease pair. TALENs have been shown to have a high success rate in targeting a wide range of genes in a number of organisms; however, recent studies suggest that TALEN binding is sensitive to cytosine methylation30,31.Thus, newly generated nuclease pairs, for example TALENs cloned into pCAG-T7 vectors, can be transfected transiently into a mouse cell line such as NIH-3T3 or Neuro-2a, which mimic the chromatin state of the mouse embryo to some extent. Here, nuclease activity can be estimated using the T7 endonuclease assay or a restriction digest of PCR product as described in section 5 prior to mRNA synthesis and microinjection. We recommend sequencing of the genomic region of interest in the respective cell line and the mouse strain used for microinjection experiments.
In mouse zygotes, different TALEN or ZFN pairs will work optimally at different mRNA concentrations and therefore the optimal working concentration of the microinjected nuclease mRNA may have to be determined experimentally. Depending on the nuclease pair, too low a concentration will result in no cleavage whereas too high can result in embryo lethality. Depending on the nuclease pair, we have had success using total mRNA concentrations as low as 2 ng/&#181;l and as high as 200 &#181;g/ul. These effects are difficult to predict from experiments in cell culture and the nuclease concentration optimal for both embryo survival and modification rate of the target locus needs to be determined empirically.
Highly active ZFN or TALEN can cleave their target sequence beyond the one-cell stage of the microinjected embryo and thus cause complex patterns of mutagenesis and mosaicism in founders. We and others4 have observed three or more distinct mutated alleles in a single founder (Figure 5C). Thus, when establishing a new mouse line from these founders, offspring should be carefully screened by sequencing for the presence of the favorable mutation since digestion assays provide evidence only that an undefined mutation is present.
One of the criticisms frequently voiced against the ZFN and TALEN systems is the possibility that these nucleases are also capable of cleaving sequences present somewhere else in the genome that are similar to the target sites. Such off-target effects have been observed with early generation reagents using the homodimeric FokI domain, and heterodimer constructs were designed to alleviate off-target effects25. Potential off-target sites can be predicted to some extent in silico32,33 and screened by PCR and sequencing. An obvious advantage of using ZFNs and TALENs for generating mice rather than cell lines is the possibility of removing off target mutations unlinked to desired genome modification by performing several backcrosses to a wild-type strain of choice. For the analysis of a large number of founder mice, next-generation deep sequencing of PCR products generated from the nuclease-targeted locus and in silico predicted off-target loci might offer an alternative qualitative and quantitative readout to the digestion assays of PCR products.
The assisted reproductive techniques described in this protocol are optimized for standard mouse strains used for microinjection experiments such as C57Bl/6J or B6D2F1. Mice of different origins, such as outbred strains, can in principle be used for genome editing approaches and might provide a more suitable genetic background for specific research questions. The performance of assisted reproductive techniques such as superovulation can be predicted for a number of strains34-36 but might require further optimization for nonstandard strains in order to obtain a sufficient number of embryos for nuclease microinjection.
Besides ZFN and TALEN, new designer nucleases such as the RNA-guided CRISPR/Cas9 system9,37,38 have now been introduced for genome editing applications. All methods for microinjection and analysis of founder animals described here are also applicable to CRISPR/Cas9 and future modes of genome editing.

Mice are by far the most popular platform for generating transgenic animal models. The versatile toolbox for genetic engineering of the mouse embryo1-3 has been recently extended by genome editing approaches based on designer nucleases such as zinc finger nucleases (ZFN)4-6, transcription activator-like effector nucleases (TALEN)7,8, and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system9. ZFN and TALEN function as pairs of two custom-designed protein-based DNA-binding domains (arrays of zinc finger proteins and repeat-variable di-residues (RVDs), respectively) that are each coupled to the FokI endonuclease10-12. Conversely, the specificity of Cas9-mediated DNA cleavage is provided by transactivating CRISPR RNAs (crRNA and tracrRNA, which can also be combined into a single chimeric RNA molecule termed guide RNA)11 that act in a complex with the CRISPR protein.
TALENs with a defined sequence of RVDs can be rapidly constructed by individual experimenters with a multitude of assembly strategies to choose from13-17. CRISPR/Cas9 promises even less labor-intensive generation of designer nucleases, however the specificity of guide RNA-DNA binding is still not completely resolved18,19. Generation of custom ZFNs has so far been limited to specialized academic laboratories and to commercial suppliers such as Sangamo Biosciences and the Sigma CompoZr service.
In general, genome editing with designer nucleases aims at introducing double strand breaks (DSB) at defined genomic loci, which subsequently attract nonhomologous end joining (NHEJ) or homologous recombination (HR) DNA repair machineries10,12. NHEJ-mediated repair of a DSB often results in the introduction of insertions and deletions in close proximity to the site of repair. Thus NHEJ repair can be exploited for knocking out the function of a target gene by introducing a frame-shift mutation within the genes protein-coding sequence4,7,9. Alternatively, defined addition or replacement of genetic information can be achieved by providing a DNA donor together with the designer nucleases. A DNA donor comprises investigator-designed DNA sequences flanked by regions of homology with the target locus, thus serving as a template for DSB repair by HR. Both plasmids5,6,20 and single-stranded oligonucleotides8,9,21&#160;have been successfully used as donors. Neither NHEJ- nor HR-mediated genome editing require the introduction of a selectable marker into the genome of the mouse embryo, which makes these strategies particularly well suited for creating small alterations in the nucleotide sequence without disturbing the overall genetic architecture.
In this protocol we describe all essential procedures for genome editing in the mouse embryo using TALENs. These include 1) identification of a TALEN target site22, 2) construction of TALENs by golden gate cloning13, 3) in vitro synthesis of TALEN mRNA, 4) microinjection of TALEN mRNA into fertilized mouse oocytes, 5) surgical procedures for embryo transfer, and 6) analysis of TALEN-induced mutagenesis in founder animals. We focus on TALEN mRNA microinjection and screening of founders for NHEJ-induced insertions/deletions. For this purpose we have generated bifunctional TALEN constructs that allow both expression in mammalian cells when transfected as plasmids and in vitro synthesis of TALEN mRNA for microinjection into mouse embryos. These constructs comprise a truncated TALE backbone23 fused to heterodimeric FokI domains24,25 for optimal genome editing in mammalian cells. This protocol can also be adopted for microinjection of other designer nucleases or for combined injections of designer nucleases and donor constructs (design of DNA donors has been described in excellent technical publications by Wefers et al.26,27).
Ethical Statement
All animal experiments were performed in accordance with the guidelines and regulations of the Cantonal Veterinary Office of Canton Zurich.

<table border="0" cellpadding="0" cellspacing="0" width="524">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">BsaI</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">R0535S or L</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Esp3I</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">ER0451</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T4 Ligase</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0202S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Spectinomycin</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">S0692-1ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ampicillin&#160;</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">A0166</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">X-Gal</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">B4252</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">IPTG</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">I6758</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Plasmid-Safe nuclease</td>
			<td style="width:111px;">Epicentre</td>
			<td style="width:119px;">E3101K</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">27106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAGEN Plasmid Midi Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">12143</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAquick PCR Purification Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">28106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">mMESSAGE mMACHINE T7 Ultra Kit</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM1345</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NucAway Spin Columns</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM10070</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNaseZAP</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">R2020-250ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NorthernMax Formaldyde Load Dye</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM8552</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNA Millennium Markers</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM7150</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">10x TBE buffer</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">B52</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T7 endonuclease</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0302S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">pGEM-T EasyVector System I</td>
			<td style="width:111px;">Promega</td>
			<td style="width:119px;">A3600</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">SYBR Green I Nucleic Acid Gel Stain</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">S-7563</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">pregnant mare&#39;s serum gonadotrophin (PMSG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">G4877</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">human chorionic gonadotropin (hCG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">CG5</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M2 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7167</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M16 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7292</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Mineral oil, embryo tested</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M8410</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ketamine</td>
			<td style="width:111px;">CentraVet</td>
			<td style="width:119px;">Ket 201</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Xylazine</td>
			<td style="width:111px;">Sigma Aldrich</td>
			<td style="width:119px;">46995</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Equipment/Tools</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Inverted microscope with Nomarski DIC optics (for example Nikon Eclipse TE200)</td>
			<td style="width:111px;">Nikon</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Micromanipulator units (for example Narishige, NT88NF)</td>
			<td style="width:111px;">&#160;Narishige</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo holding capillaries</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;">B100-75-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo injection capillaries</td>
			<td style="width:111px;">Narishige</td>
			<td style="width:119px;">GD-1</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Capillary puller (for example Sutter P97)</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Microforge (for example Narishige MF-900)</td>
			<td style="width:111px;">Narishige&#160;</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Walton skin scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14077-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14041-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical probe</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">10140-03</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clip system (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12031-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clips (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12032-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dumont fine forceps 5</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11254-20</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria curvrd forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11370-31</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria fine forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11399-80</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dietrich bulldog clamp</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">18038-45</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Animals</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">C57BL/6J mice</td>
			<td style="width:111px;">Jackson labs</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">CD-1 mice</td>
			<td style="width:111px;">Charles river</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
	</tbody>
</table>

mouse genome engineering using designer nucleases

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well as for modeling human diseases and testing therapeutic strategies. Recent advances in the use of designer nucleases such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system for site-specific genome engineering open the possibility to perform rapid targeted genome modification in virtually any laboratory species without the need to rely on embryonic stem (ES) cell technology. A genome editing experiment typically starts with identification of designer nuclease target sites within a gene of interest followed by construction of custom DNA-binding domains to direct nuclease activity to the investigator-defined genomic locus. Designer nuclease plasmids are in vitro transcribed to generate mRNA for microinjection of fertilized mouse oocytes. Here, we provide a protocol for achieving targeted genome modification by direct injection of TALEN mRNA into fertilized mouse oocytes.

We constructed destination plasmids compatible with the Golden GateTALEN assembly published by Cermak et al.13 that allow expression of TALENs in mammalian cells as well as in vitro mRNA synthesis from the T7 phage promoter (Figure 1C). These plasmids carry heterodimeric FokI domains (ELD or KKR mutations) that have been shown to reduce off-target effects relative to FokI homodimers and to enhance cleavage activity as compared to first generation FokI heterodimers25,29. Golden gate assembly reactions #1 and #2 are usually very efficient and every white colony, when analyzed by colony PCR, shows the expected pattern for the particular number of RVDs cloned (Figures 1B and 1D).
Gel analysis of in vitro synthesized mRNA (Figure 2) should reveal a single distinguishable band with little or no smear for every sample analyzed. There should be a clear size shift between samples L1/R1 and L2/R2, L3/R3, which indicates successful polyadenylation.
Founder animals can be screened for NHEJ-induced mutated alleles using genotyping PCR followed by either T7 endonuclease digestion (Figure 3) or a restriction digest using an enzyme that cleaves the wild type sequence within the spacer region of the nuclease pair (Figure 4). The T7 endonuclease assay is applicable to any kind of mutation irrespective of the specific genomic sequence within the spacer region of the nuclease pair injected; however, it detects only mismatches between DNA strands in heteroduplex PCR products. Thus, in the rare event that a founder carries two identically mutated alleles, PCR products would not show any T7 digestion pattern. Such distinction is, however, always possible when a specific restriction site is located within the nuclease spacer region that will be eliminated by NHEJ-induced insertions/deletions (Figure 5). Here, undigested bands indicate the presence of mutations, and the absence of any digested products strongly suggests a founder carrying mutations in both alleles of the targeted gene (marked with asterisks in Figure 4b).
<img alt="Figure 1" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig1highres.jpg" src="/files/ftp_upload/50930/50930fig1.jpg" width="600" /> 
Figure 1. Golden Gate cloning of TALEN RVDs into heterodimeric pCAG-T7-Destination vectors. A) Assembly of RVD arrays into pFUS vectors. Here an example is shown for a TALEN pair with individual TALE arrays comprising 15 RVDs and 17 RVDs, respectively (for TALE arrays longer than 21 RVDs, three pFUS-RVDs assemblies are required, not shown). Arrows indicate primers for pFUS-specific colony PCR reactions. B) PCR products amplified from correct pFUS assemblies typically show a band corresponding to the combined length of all RVDs cloned (e.g. around 1.1 kb for 10 RVDs) and a &#34;ladder&#34; of smaller less prominent bands due to the repetitive nature of RVD arrays. C) Final assembly of pFUS-RVD arrays and a plasmid containing the last repeat (pLR) into heterodimeric TALEN expression vectors with FokIELD and FokIKKR variants, respectively. The TALEN backbone (annotated as N and C) resembles the architecture published by Miller et al.23 The CAG (CMV early enhancer element/ chicken beta-actin) promoter ensures high expression levels in transfected mammalian cells, while the T7 phage promoter allows in vitro mRNA synthesis (use SacI for linearization of the vector downstream of the nuclease STOP codon). D) Colony PCR using primers indicated by arrows in C) allows identification of correctly assembled TALENs. Full-length PCR products are often less prominent while the &#34;ladder effect&#34; represents a robust indicator of successful assembly. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig1highres.jpg" target="_blank">Click here to view larger image</a>.
<img alt="Figure 2" fo:content-width="3in" fo:src="/files/ftp_upload/50930/50930fig2highres.jpg" src="/files/ftp_upload/50930/50930fig2.jpg" width="300" /> 
Figure 2. Quality control of nuclease mRNA in vitro synthesis using agarose gel electrophoresis. ZFN mRNAs are shown as an example (L, left ZFN; R, right ZFN). Samples L1/R1 show mRNA prior to polyadenylation, samples L2/R2 show polyadenylated mRNA and L3/R3 show purified polyadenylated mRNA. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig2highres.jpg" target="_blank">Click here to view larger image</a>.
<img alt="Figure 3" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig3highres.jpg" src="/files/ftp_upload/50930/50930fig3.jpg" width="600" /> 
Figure 3. Example of a T7 endonuclease assay used for identification of founder animals carrying nuclease-induced mutations of the target locus. A) A TALEN pair was designed to cleave within the coding region of the mouse prion protein gene (Prnp, TALEN target sequence can be provided upon request). A PCR product is generated using a forward primer (F) located 110 bp upstream and a reverse primer (R) 250 bp downstream of the TALEN cleavage site. B) The PCR product is subsequently subjected to heteroduplex formation and T7 endonuclease digestion. C) TALEN-induced mutagenesis within the targeted genomic region of single founders is revealed by the presence of a full-length PCR product with digestion products of 250 and 110 bps. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig3highres.jpg" target="_blank">Click here to view larger image</a>.
<img alt="Figure 4" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig4highres.jpg" src="/files/ftp_upload/50930/50930fig4.jpg" width="600" /> 
Figure 4. Example of a restriction digest of PCR products used for identification of founder animals carrying nuclease-induced mutations of the target locus. ZFN specific for the mouse Rosa26 locus29 target a XbaI restriction site within intron 1. A) Founders were screened by genotyping PCR using a forward primer (F) located 500 bp upstream and a reverse primer (R) 250 bp downstream of the cleavage site. B) Digestion of PCR products with XbaI reveals digestion patterns indicating mice with bi-allelic mutations (marked with asterisks), mono-allelic mutations (digested and undigested bands, e.g. animal 2) and wt mice (complete digestion, e.g. animal 21). C) Sequencing of mice with potential bi-allelic modifications shows up to 3 (animal 24) distinct insertions/deletions. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig4highres.jpg" target="_blank">Click here to view larger image</a>.
<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Name of Primer</td>
			<td>Sequence 5&#8217; to 3&#8217;</td>
		</tr>
		<tr>
			<td>pCR8_F1</td>
			<td>ttgatgcctggcagttccct</td>
		</tr>
		<tr>
			<td>pCR8_R1</td>
			<td>cgaaccgaacaggcttatgt</td>
		</tr>
		<tr>
			<td>TAL_F1</td>
			<td>ttggcgtcggcaaacagtgg</td>
		</tr>
		<tr>
			<td>TAL_R2</td>
			<td>ggcgacgaggtggtcgttgg</td>
		</tr>
		<tr>
			<td>TAL_Seq_5-1</td>
			<td>catcgcgcaatgcactgac</td>
		</tr>
	</tbody>
</table>
Table 1. Sequences of primers used for colony PCRs and sequencing within the Golden Gate TALEN assembly protocol.
<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Plasmid/Collection</td>
			<td>Contributor</td>
			<td>Addgene ID</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Golden Gate TALEN and TAL Effector Kit 2.0</td>
			<td>Voytas lab</td>
			<td>1000000024</td>
			<td>Contains all plasmids necessary for Golden Gate TALEN assembly</td>
		</tr>
		<tr>
			<td>pCAG-T7-TALEN -KKR/ELD destination vectors</td>
			<td>Pelczar lab</td>
			<td>40131, 40132</td>
			<td>Add-on plasmids for TALEN expression in mammalian cells and in vitro mRNA synthesis</td>
		</tr>
	</tbody>
</table>
Table 2. Plasmids and plasmid collections required for Golden Gate TALEN assembly can be obtained from Addgene (<a href="http://www.addgene.org">www.addgene.org</a>).
<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Online Resource</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>http://tale-nt.cac.cornell.edu</td>
			<td>Design of TALEN; TALEN off-target prediction</td>
		</tr>
		<tr>
			<td>http://zifit.partners.org/ZiFiT/</td>
			<td>Design of TALEN, OPEN ZFN, CoDA ZFN, CRISPR/Cas9</td>
		</tr>
		<tr>
			<td>http://www.genome-engineering.org</td>
			<td>Design of TALEN, CRISPR/Cas9; CRISPR/Cas9 off-target prediction</td>
		</tr>
		<tr>
			<td>http://baolab.bme.gatech.edu/Research/BioinformaticTools/assembleTALSequences.html</td>
			<td>Assembly of TALEN sequences for confirmation of sequencing results</td>
		</tr>
		<tr>
			<td>http://pgfe.umassmed.edu/ZFPmo dularsearchV2.html</td>
			<td>Design of modular assembly ZFN </td>
		</tr>
		<tr>
			<td>www.genomecenter.ucdavis.edu/s egallab/segallabsoftware</td>
			<td>Design of modular assembly ZFN</td>
		</tr>
	</tbody>
</table>
Table 3. Online resources for designing ZFN, TALEN, and CRISPR/Cas9.

Watch this Scientific Journal Video about Mouse Genome Engineering Using Designer Nucleases at JoVE.com

Mouse Genome Engineering Using Designer Nucleases

Designer nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) can be used to modify the genome of mouse preimplantation embryos by triggering both the nonhomologous end joining (NHEJ) and homologous recombination (HR) pathways. These advances enable the rapid generation of mice with precise genetic modifications.

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

mouse-genome-engineering-using-designer-nucleases

Research

JoVE Journal

Biology

28.7K ビュー.  University of Zurich. このようなジンクフィンガーヌクレアーゼ（ZFNを）および転写活性化因子のようなエフェクターヌクレアーゼ（TALENS）などのデザイナーヌクレアーゼは非相同エンド入社（NHEJ）と相同組換え（HR）経路の両方をトリガすることによって、マウスの着床前胚のゲノムを変更するために使用することができます。これらの進歩は、正確な遺伝子改変マウスの?...

ビデオ: Mouse Genome Engineering Using Designer Nucleases

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish (Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the cellular and molecular features of the epithelia, which are mainly composed of two types of cells: hair cells (HCs) and supporting cells (SCs). Here we choose to study the inner ear sensory epithelia in adult zebrafish not only because the epithelial structures are highly conserved in all vertebrates studied, but also because the adult zebrafish is able to regenerate HCs, an ability that mammals lose shortly after birth. We use the inner ear of adult zebrafish as a model system to study the mechanisms of inner ear HC regeneration in adult vertebrates that could be helpful for clinical therapy of hearing/balance deficits in human as a result of HC loss.
Here we demonstrate how to do gross and fine dissections of inner ear sensory epithelia in adult zebrafish. The gross dissection removes the tissues surrounding the inner ear and is helpful for preparing tissue sections, which allows us to examine the detailed structure of the sensory epithelia. The fine dissection cleans up the non-sensory-epithelial tissues of each individual epithelium and enables us to examine the heterogeneity of the whole epithelium easily in whole-mount epithelial samples.

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish Danio rerio

The inner ear sensory epithelium of adult zebrafish is a good model system for understanding the mechanisms of hair cell regeneration in adult vertebrates. This protocol demonstrates the fine dissection of the epithelia, through which we can get tissue samples for studying the regenerative events at cellular and subcellular levels.

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the ...

Genome-wide Analysis of Aminoacylation (Charging) Levels of tRNA Using Microarrays

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both prokaryotic and eukaryotic cells lead to translational regulation which is a major cellular mechanism of stress response. Familiar examples are the stringent response in E. coli and the Gcn2 stress response pathway in yeast ([2-6]). Recent work in E. coli and S. cerevisiae have shown that tRNA charging patterns are highly dynamic and depends on the type of stress experienced by cells [1, 6, 7]. The highly dynamic, variable nature of tRNA charging makes it essential to determine changes in tRNA charging levels at the genomic scale, in order to fully elucidate cellular response to environmental variations. In this review we present a method for simultaneously measuring the relative charging levels of all tRNAs in S. cerevisiae . While the protocol presented here is for yeast, this protocol has been successfully applied for determining relative charging levels in a wide variety of organisms including E. coli and human cell cultures[7, 8].

Genome-wide Analysis of Aminoacylation Charging Levels of tRNA Using Microarrays

We describe a method for microarray analysis to determine relative aminoacylation levels of all tRNAs from S. cerivisiae.

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both ...

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

Human cancer and response to therapy is better represented in orthotopic animal models. This paper describes the development of an orthotopic mouse model of ovarian cancer, treatment of cancer via oral delivery of drugs, and monitoring of tumor cell behavior in response to drug treatment in real time using in vivo imaging system. In this orthotopic model, ovarian tumor cells expressing luciferase are applied topically by injecting them directly into the mouse bursa where each ovary is enclosed. Upon injection of D-luciferin, a substrate of firefly luciferase, luciferase-expressing cells generate bioluminescence signals. This signal is detected by the in vivo imaging system and allows for a non-invasive means of monitoring tumor growth, distribution, and regression in individual animals. Drug administration via oral gavage allows for a maximum dosing volume of 10 mL/kg body weight to be delivered directly to the stomach and closely resembles delivery of drugs in clinical treatments. Therefore, techniques described here, development of an orthotopic mouse model of ovarian cancer, oral delivery of drugs, and in vivo imaging, are useful for better understanding of human ovarian cancer and treatment and will improve targeting this disease.

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

Orthotopic animal models of ovarian cancer replicate better human disease and therefore enhance our understanding of cancer progression and tumor response to therapy. A mouse model receives an intrabursal injection of luciferase-expressing ovarian tumor cells. Treatment is administered via oral gavage. Tumor growth is monitored by in vivo imaging system.

Human cancer and response to therapy is better represented in orthotopic animal models.  This paper describes the development of an orthotopic mouse model ...

Flow Cytometry Purification of Mouse Meiotic Cells

The heterogeneous nature of cell types in the testis and the absence of meiotic cell culture models have been significant hurdles to the study of the unique differentiation programs that are manifest during meiosis. Two principal methods have been developed to purify, to varying degrees, various meiotic fractions from both adult and immature animals: elutriation or Staput (sedimentation) using BSA and/or percoll gradients. Both of these methods rely on cell size and density to separate meiotic cells1-5. Overall, except for few cell populations6, these protocols fail to yield sufficient purity of the numerous meiotic cell populations that are necessary for detailed molecular analyses. Moreover, with such methods usually one type of meiotic cells can be purified at a given time, which adds an extra level of complexity regarding the reproducibility and homogeneity when comparing meiotic cell samples.
Here, we describe a refined method that allows one to easily visualize, identify, and purify meiotic cells, from germ cells to round spermatids, using FACS combined with Hoechst 33342 staining7,8. This method provides an overall snapshot of the entire meiotic process and allows one to highly purify viable cells from most stage of meiosis. These purified cells can then be analyzed in detail for molecular changes that accompany progression through meiosis, for example changes in gene expression9,10and the dynamics of nucleosome occupancy at hotspots of meiotic recombination11.

An efficient method to obtain highly purified viable meiotic fractions from mouse testis is described, which combines a refined cell dissociation protocol with fluorescent activated cell sorting (FACS). This method takes advantage of differences in the DNA content and nuclear density of discrete meiotic fractions.

The heterogeneous nature of cell types in the testis and the absence of meiotic cell culture models have been significant hurdles to the study of the ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such as chemical-based mutagenesis or random integration of DNA sequences confer indiscriminate genetic changes in an overall inefficient manner and require incorporation of undesirable synthetic sequences or use of aberrant culture conditions, potentially confusing biological study. By contrast, transient ZFN expression in a cell can facilitate precise, heritable gene editing in a highly efficient manner without the need for administration of chemicals or integration of synthetic transgenes.
Zinc finger nucleases (ZFNs) are enzymes which bind and cut distinct sequences of double-stranded DNA (dsDNA). A functional CompoZr ZFN unit consists of two individual monomeric proteins that bind a DNA "half-site" of approximately 15-18 nucleotides (see Figure 1). When two ZFN monomers "home" to their adjacent target sites the DNA-cleavage domains dimerize and create a double-strand break (DSB) in the DNA.1 Introduction of ZFN-mediated DSBs in the genome lays a foundation for highly efficient genome editing. Imperfect repair of DSBs in a cell via the non-homologous end-joining (NHEJ) DNA repair pathway can result in small insertions and deletions (indels). Creation of indels within the gene coding sequence of a cell can result in frameshift and subsequent functional knockout of a gene locus at high efficiency.2 While this protocol describes the use of ZFNs to create a gene knockout, integration of transgenes may also be conducted via homology-directed repair at the ZFN cut site.
The CompoZr Custom ZFN Service represents a systematic, comprehensive, and well-characterized approach to targeted gene editing for the scientific community with ZFN technology. Sigma scientists work closely with investigators to 1) perform due diligence analysis including analysis of relevant gene structure, biology, and model system pursuant to the project goals, 2) apply this knowledge to develop a sound targeting strategy, 3) then design, build, and functionally validate ZFNs for activity in a relevant cell line. The investigator receives positive control genomic DNA and primers, and ready-to-use ZFN reagents supplied in both plasmid DNA and in-vitro transcribed mRNA format. These reagents may then be delivered for transient expression in the investigator&#x2019;s cell line or cell type of choice. Samples are then tested for gene editing at the locus of interest by standard molecular biology techniques including PCR amplification, enzymatic digest, and electrophoresis. After positive signal for gene editing is detected in the initial population, cells are single-cell cloned and genotyped for identification of mutant clones/alleles.

Genome Editing with CompoZr Custom Zinc Finger Nucleases ZFNs

The CompoZr Custom Zinc-Finger Nuclease (ZFN) Service enables precise genome editing in any organism or cell line at any locus defined by the user. This article describes the process for the design, manufacture, validation and implementation of the CompoZr Custom ZFN Service.

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also produce a source of patient-matched cells for regenerative therapies. iPSCs may be generated using multiple protocols and derived from multiple cell sources. Once generated, iPSCs are tested using a variety of assays including immunostaining for pluripotency markers, generation of three germ layers in embryoid bodies and teratomas, comparisons of gene expression with embryonic stem cells (ESCs) and production of chimeric mice with or without germline contribution2. Importantly, iPSC lines that pass these tests still vary in their capacity to produce different differentiated cell types2. This has made it difficult to establish which iPSC derivation protocols, donor cell sources or selection methods are most useful for different applications.
The most stringent test of whether a stem cell line has sufficient developmental potential to generate all tissues required for survival of an organism (termed full pluripotency) is tetraploid embryo complementation (TEC)3-5. Technically, TEC involves electrofusion of two-cell embryos to generate tetraploid (4n) one-cell embryos that can be cultured in vitro to the blastocyst stage6. Diploid (2n) pluripotent stem cells (e.g. ESCs or iPSCs) are then injected into the blastocoel cavity of the tetraploid blastocyst and transferred to a recipient female for gestation (see Figure 1). The tetraploid component of the complemented embryo contributes almost exclusively to the extraembryonic tissues (placenta, yolk sac), whereas the diploid cells constitute the embryo proper, resulting in a fetus derived entirely from the injected stem cell line.
Recently, we reported the derivation of iPSC lines that reproducibly generate adult mice via TEC1. These iPSC lines give rise to viable pups with efficiencies of 5-13%, which is comparable to ESCs3,4,7 and higher than that reported for most other iPSC lines8-12. These reports show that direct reprogramming can produce fully pluripotent iPSCs that match ESCs in their developmental potential and efficiency of generating pups in TEC tests. At present, it is not clear what distinguishes between fully pluripotent iPSCs and less potent lines13-15. Nor is it clear which reprogramming methods will produce these lines with the highest efficiency. Here we describe one method that produces fully pluripotent iPSCs and "all- iPSC" mice, which may be helpful for investigators wishing to compare the pluripotency of iPSC lines or establish the equivalence of different reprogramming methods.

Generating induced pluripotent stem cell (iPSC) lines produces lines of differing developmental potential even when they pass standard tests for pluripotency. Here we describe a protocol to produce mice derived entirely from iPSCs, which defines the iPSC lines as possessing full pluripotency1.

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs. Towards this end, much recent work has focused on identifying candidate genes for the evolution of traits in a variety of species. However, until recently it has been challenging to functionally validate interesting candidate genes. Recently developed tools for genetic engineering make it possible to manipulate specific genes in a wide range of organisms. Application of this technology in evolutionarily relevant organisms will allow for unprecedented insight into the role of candidate genes in evolution. Astyanax mexicanus (A. mexicanus) is a species of fish with both surface-dwelling and cave-dwelling forms. Multiple independent lines of cave-dwelling forms have evolved from ancestral surface fish, which are interfertile with one another and with surface fish, allowing elucidation of the genetic basis of cave traits. A. mexicanus has been used for a number of evolutionary studies, including linkage analysis to identify candidate genes responsible for a number of traits. Thus, A. mexicanus is an ideal system for the application of genome editing to test the role of candidate genes. Here we report a method for using transcription activator-like effector nucleases (TALENs) to mutate genes in surface A. mexicanus. Genome editing using TALENs in A. mexicanus has been utilized to generate mutations in pigmentation genes. This technique can also be utilized to evaluate the role of candidate genes for a number of other traits that have evolved in cave forms of A. mexicanus.

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs

Gene-targeting mutagenesis is now possible in a wide range of organisms using genome editing techniques. Here, we demonstrate a protocol for targeted gene mutagenesis using transcription activator like effector nucleases (TALENs) in Astyanax mexicanus, a species of fish that includes surface fish and cavefish.

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs.  Towards this end, much recent ...