This work was made possible by grants to JK from the Ontario Centres of Excellence and the Ontario Research Fund.
We would like to thank Siddika Pardhan and Dr. Peter Ferguson for technical assistance during filming.

NOTE: The following protocol was designed for use with adherent cells. Modifications are required to apply the method to non-adherent cells grown in suspension. The CAM experiments described in the protocol are designed for use with cells that express a fluorescent marker (e.g., GFP, RFP, etc.). Nine day old chicken embryos are required on day 2 of the experimental protocol for the CAM experiments.
1. Preparation and Transfection of Tumor Cells with Antisense Oligonucleotides (ASOs)
<ol>
	<li>Aspirate medium from T75 flask(s) containing cells of interest, wash with 1XPBS, and add 2 ml of 0.25% trypsin/EDTA. Add 10 ml of complete growth medium to each flask and transfer the cells in solution to a 50 ml tube. Count the cells and adjust the volume so that the final concentration is 1.0x105 cells per ml.</li>
	<li>Label two groups of T25 flasks: one group will contain eight flasks, labeled 1-8, and will be used for the real-time metabolism measurementexperiment; and the second group will also contain 8 flasks and will be used for the chicken embryo CAMexperiment. Add 2 ml of cells in solution to each flask and place in the incubator (37 &#176;C, 5% CO2 O/N).</li>
	<li>The next morning (Day 0, Time 0), label three 5 ml tubes as follows: control (non-targeting ASO or siRNA), &#39;target of interest&#39; (i.e., targeting ASO or siRNA), and Lipofectamine 2000 (or a similar transfection reagent). Dilute the stock ASO solutions to the appropriate concentration with serum free medium in the appropriate tube.
	<ol>
		<li>Add the required amount of transfection reagent to the appropriate tube and incubate in serum-free medium for 5 min. Add the transfection reagent solution to the ASO tubes and incubate for 20 min.</li>
	</ol>
	</li>
	<li>Add 250 &#181;l of control ASO transfection reagent solution to each of flasks 1-4 in each group, and 250 &#181;l of &#39;target of interest&#39; ASO transfection reagent solution to each of flasks 5-8 in each group. Incubate for 4 hr (37 &#7506;C, 5% CO2).
	<ol>
		<li>During incubation, carry out the steps described in section 2.1. After the incubation, add 3 ml of complete medium to each flask in the CAM experiment group and return to the incubator O/N (37 &#7506;C, 5% CO2). Process the metabolismexperiment group according to the description in section 2.2. Process the CAM experiment set according to the description in section 4.</li>
	</ol>
	</li>
</ol>
2. Biosensor Chip Preparation and Cell Seeding
<ol>
	<li>In a sterile environment, carefully wash six biosensor chips with 400 &#181;l of PBS. Sterilize the chips with 400 &#181;l of 70% ethanol for 20 min. Wash three times with 400 &#181;l of PBS.
	<ol>
		<li>Place the chips inside sterile tissue culture dishes to prevent contamination. Place three chips in a dish labeled &#39;control&#39;, and three in a dish labeled &#39;target of interest&#39;.</li>
	</ol>
	</li>
	<li>Label two 50 ml tubes as &#39;control&#39; and &#39;target of interest&#39;. Wash cells with PBS and add an appropriate volume of 0.25% Trypsin/EDTA. Wait until the monolayer detaches and collect the cells from each flask. Deposit the solution into the appropriate tube.
	<ol>
		<li>Count the cells and adjust the volume so that the final concentration is 6.0x105 cells/ml. Centrifuge and resuspend the cells if the initial concentration is too low.</li>
	</ol>
	</li>
	<li>Add 250 &#181;l of the cell solution to each biosensor chip in the appropriate group (for a total of 1.25x105 cells per chip). Perform this task one group at a time to minimize the risk of confusing the chips. Place the sterile dishes containing the chips inside a humidity chamber to prevent evaporation, and place the humidity chamber in the incubator O/N (37 &#7506;C, 5% CO2).</li>
	<li>The next morning (Day 1), carefully aspirate the medium from each chip and replace it with 250 &#181;l of growth medium supplemented with 0.2% fetal bovine serum (FBS) and 1x penicillin and streptomycin (P/S). Incubate for 4 hr (37 &#7506;C, 5% CO2).</li>
</ol>
3. Metabolism Measurement System Preparation and Solution Preparation
<ol>
	<li>During the incubation, prepare the requisite drug solutions and the metabolism measurement system for the upcoming assay. 
	NOTE: The metabolism measurement system contains a total of six modules. Each module accommodates one chip per experiment.
	<ol>
		<li>Subdivide the assay into the following experimental groups: one chip from each of the &#39;control&#39; and &#39;target of interest&#39; groups to receive vehicle for the duration of the assay; two chips from each group to receive drug treatment for a defined period of time during the assay, followed by vehicle during the washout period.</li>
		<li>For drug sensitization studies, modify the length, timing, and concentration of drug treatment to suit the particular drug in question. 
		NOTE: For cisplatin, the following steps were determined empirically with A549 cells, and may vary depending on cell line. Perform all stages with the default flow rate of 4 &#181;l/min. 
		6 hr of growth medium + 0.2% FBS and 1x P/S 
		24 hr of 6 &#181;M cisplatin in medium + 0.2% FBS 1x P/S 
		24 hr of growth medium + 0.2% FBS and 1x P/S 
		18 hr of growth medium + 0.2% FBS and 1x P/S 
		4 hr of 0.1% Triton-X 
		NOTE: Deviations from these steps will require calculation to determine the required volume of medium and drug solutions based on the desired flow rate and duration of experiment. The following sections are based on the steps described above.</li>
	</ol>
	</li>
	<li>Label and fill fourteen 50 ml tubes with 50 ml of growth medium + 0.2% FBS and 1x P/S. Place six in one metabolism measurement system tube rack, six in another, and the remaining two in a third tube rack that also contains tubes with cisplatin. Seal the first two racks with an air permeable membrane to prevent evaporation.</li>
	<li>Prepare a solution of 6 &#181;M cisplatin (of the appropriate volume) in medium + 0.2% FBS with 1x P/S. Dispense the required volume of cisplatin solution into four labeled 50 ml tubes.
	<ol>
		<li>Place the tubes in the remaining four slots in the third metabolism measurement tube rack. Ensure that the tubes are placed in the appropriate slots that correspond to the desired biomodules. Seal the tubes with an air permeable membrane.</li>
	</ol>
	</li>
	<li>Prepare and label six 50 ml tubes and fill them with 20 ml each of 0.1% Triton-X solution in medium. The Triton-X solution will lyse any remaining cells and provide a &#39;zero&#39; value for each chip. Place the tubes in a fourth metabolism measurement unit tube rack and seal with an air permable membrane to prevent excessive evaporation.</li>
	<li>Load the chips into the biomodules and initiate the experiment.</li>
</ol>
4. CAM Experiment Drug Treatment and Injection
NOTE: The steps and procedure for preparing chicken embryos for a CAM experiment are described elsewhere19
<ol>
	<li>Begin processing the CAM experiment 48 hr post-transfection (Day 2). Sub-divide the &#39;control&#39; and &#39;target of interest&#39; groups into two flasks for vehicle, and two for cisplatin. Aspirate the medium from the flasks and replenish with either 3 ml of fresh medium, or 6 &#181;M cisplatin. Incubate for 6 hr (37 &#7506;C, 5% CO2).</li>
	<li>Aspirate the medium, then wash and trypsinize the cells; collect the trypsinized cells in solution into four appropriately labeled 15 ml tubes.
	<ol>
		<li>Centrifuge and wash the cells three times with PBS. Re-suspend the cell pellet in 5 ml of PBS and count the cells.</li>
		<li>Adjust the volume so that the final cell concentration is 1.0x106 cells/ml. Transfer the cell solution into labeled 5 ml tubes for injection, and place on ice. Invert the tubes gently prior to injection to ensure that the cells are well mixed.</li>
	</ol>
	</li>
	<li>Set aside a total of 24 chicken embryos (9 days old) for injection (6 per group). Perform the injection using a glass needle attached to a flexible tube connected to a 1 ml syringe. The individual performing the injection should be blinded to the treatment group.
	<ol>
		<li>Using a stereo microscope, inject 1.0x105 cells in a volume of 100 &#181;l into the venous circulation of the CAM. Use a slow, pulsating technique to inject the full volume of cells. Gently dab the injection site with a soft wipe to stem the flow of blood and absorb any spillage. Label each embryo container appropriately following each injection.</li>
	</ol>
	</li>
	<li>Confirm the presence and distribution of fluorescent cells in the vasculature of the CAM following injection by visualizing them using a fluorescent microscope. Take note of any embryos in which the number of tumor cells appears low, or the distribution is poor.</li>
	<li>Place the chicken embryos in a humidity chamber and store them in an incubator (37 &#176;C, 60% humidity). Wait 7-9 days before enumerating metastatic foci.</li>
</ol>
5. Metastatic Focus Enumeration
<ol>
	<li>During the 7-9 day incubation period, monitor the embryos and discard any dead ones. Ensure that the humidity chamber remains moist at all times during the incubation period.</li>
	<li>Using a fluorescent stereo microscope at 20X magnification, scan the entire upper surface of the embryo CAM in a regular, grid-like pattern.</li>
	<li>Count the number of metastatic foci in each field of view, then tally the number for a final total per embryo. Doing so for the six embryos in each group will provide an average number of metastatic foci per treatment.</li>
</ol>

<ol>
	<li>Bouwman, P., Jonkers, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+deregulated+DNA+damage+signalling+on+cancer+chemotherapy+response+and+resistance.">The effects of deregulated DNA damage signalling on cancer chemotherapy response and resistance.</a> Nat Rev Cancer. 12, 587-598 (2012).</li><li>Bozic, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+dynamics+of+cancer+in+response+to+targeted+combination+therapy.">Evolutionary dynamics of cancer in response to targeted combination therapy.</a> Elife. 2, e00747 (2013).</li><li>Diaz, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+evolution+of+acquired+resistance+to+targeted+EGFR+blockade+in+colorectal+cancers.">The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers.</a> Nature. 486, 537-540 (2012).</li><li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+BRCA2+and+Thymidylate+Synthase+Creates+Multidrug+Sensitive+Tumor+Cells+via+the+Induction+of+Combined+'Complementary+Lethality'.">Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined 'Complementary Lethality'.</a> Mol Ther Nucleic Acids. 2, e78 (2013).</li><li>Lord, C. J., Ashworth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA+damage+response+and+cancer+therapy.">The DNA damage response and cancer therapy.</a> Nature. 481, 287-294 (2012).</li><li>Helleday, T., Petermann, E., Lundin, C., Hodgson, B., Sharma, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+pathways+as+targets+for+cancer+therapy.">DNA repair pathways as targets for cancer therapy.</a> Nat Rev Cancer. 8, 193-204 (2008).</li><li>Shaheen, M., Allen, C., Nickoloff, J. A., Hromas, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+lethality:+exploiting+the+addiction+of+cancer+to+DNA+repair.">Synthetic lethality: exploiting the addiction of cancer to DNA repair.</a> Blood. 117, 6074-6082 (2011).</li><li>Green, S., Benedetti, J., Smith, A., Crowley, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Clinical trials in oncology. 28, (2012).</li><li>Begley, C. G., Ellis, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drug+development:+Raise+standards+for+preclinical+cancer+research.">Drug development: Raise standards for preclinical cancer research.</a> Nature. 483, 531-533 (2012).</li><li>Galluzzi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+definitions+of+cell+death+subroutines:+recommendations+of+the+Nomenclature+Committee+on+Cell+Death+2012.">Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012.</a> Cell Death Differ. 19, 531-533 (2012).</li><li>Ruggeri, B. A., Camp, F., Miknyoczki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+disease:+pre-clinical+animal+models+of+cancer+and+their+applications+and+utility+in+drug+discovery.">Animal models of disease: pre-clinical animal models of cancer and their applications and utility in drug discovery.</a> Biochem Pharmacol. 87, 150-161 (2014).</li><li>Kwon, M. C., Berns, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+for+lung+cancer.">Mouse models for lung cancer.</a> Mol Oncol. 7, 165-177 (2013).</li><li>Young, M., Ordonez, L., Clarke, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+are+the+best+routes+to+effectively+model+human+colorectal+cancer.">What are the best routes to effectively model human colorectal cancer.</a> Mol Oncol. 7, 178-189 (2013).</li><li>Sharma, S. V., Haber, D. A., Settleman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-based+platforms+to+evaluate+the+therapeutic+efficacy+of+candidate+anticancer+agents.">Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents.</a> Nat Rev Cancer. 10, 241-253 (2010).</li><li>Garnett, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+genomic+markers+of+drug+sensitivity+in+cancer+cells.">Systematic identification of genomic markers of drug sensitivity in cancer cells.</a> Nature. 483, 570-575 (2012).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+cisplatin-induced+cell+death.">Real-time monitoring of cisplatin-induced cell death.</a> PLoS One. 6, e19714 (2011).</li><li>Cvetkovic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KISS1R+induces+invasiveness+of+estrogen+receptor-negative+human+mammary+epithelial+and+breast+cancer+cells.">KISS1R induces invasiveness of estrogen receptor-negative human mammary epithelial and breast cancer cells.</a> Endocrinology. 154, 1999-2014 (2013).</li><li>Leong, H. S., Chambers, A. F., Lewis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessing+cancer+cell+migration+and+metastatic+growth+in+vivo+in+the+chick+embryo+using+fluorescence+intravital+imaging.">Assessing cancer cell migration and metastatic growth in vivo in the chick embryo using fluorescence intravital imaging.</a> Methods Mol Biol. 872, 1-14 (2012).</li><li>Hung, Y. P., Albeck, J. G., Tantama, M., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+cytosolic+NADH-NAD(+)+redox+state+with+a+genetically+encoded+fluorescent+biosensor.">Imaging cytosolic NADH-NAD(+) redox state with a genetically encoded fluorescent biosensor.</a> Cell Metab. 14, 545-554 (2011).</li><li>Tantama, M., Hung, Y. P., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+intracellular+pH+in+live+cells+with+a+genetically+encoded+red+fluorescent+protein+sensor.">Imaging intracellular pH in live cells with a genetically encoded red fluorescent protein sensor.</a> J Am Chem Soc. 133, 10034-10037 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA2+inhibition+enhances+cisplatin-mediated+alterations+in+tumor+cell+proliferation,+metabolism,+and+metastasis.">BRCA2 inhibition enhances cisplatin-mediated alterations in tumor cell proliferation, metabolism, and metastasis.</a> Mol. Onc. 8 (8), 1429-1440 (2014).</li></ol>

The authors have nothing to disclose.

Due to the inherent cost and risk associated with clinical trials, there is a need to develop better and more rigorous pre-clinical testing methodology to adequately evaluate novel anti-cancer treatment regimens. Current commonly-used techniques all exhibit weaknesses that may limit their capacity to discriminate between potentially promising therapeutic targets/agents, and those that may be less effective. We devised a protocol to evaluate new anti-cancer approaches that addresses many of the shortcomings of traditional...

Acquired resistance to targeted and/or cytotoxic cancer treatment is an important clinical problem that can lead to treatment failure, relapse, and increased patient mortality1. Given the high level of heterogeneity in most tumors, it is a mathematical certainty that a tumor of sufficiently high cell number will contain a subset of cells resistant to single or combined therapies targeting molecular pathways on which those cells depend for survival2,3. Such tumor cells can be positively selected for during treatment, leading to disease recurrence. Development of novel therapies that simultaneously target different cancer cell survival mechanisms, either before or after treatment-mediated selection, is thus clinically important.
A high level of genome instability and mutation in tumor genomes is a fundamental characteristic that distinguishes cancer cells from non-tumor host cells4. Consequently, a useful strategy to increase the effectiveness of DNA-damaging chemotherapy and to prevent the development of resistance is to actively inhibit DNA repair in tumor cells5. This is an active field of investigation and a variety of novel DNA repair targets are being explored in a pre-clinical setting. A number of small molecule or antisense-based inhibitors of these targets have been developed and are undergoing testing6-8. The objective is to identify the most promising pre-clinical candidates and evaluate their safety and efficacy in clinical trials.
The high cost of clinical trials and the risk of failure (for a variety of reasons including sub-optimal pre-clinical evaluation) are formidable obstacles to progress in development of new therapies9. The use of appropriate and rigorous pre-clinical models to adequately evaluate new therapeutic targets and candidate drugs may decrease the high failure rate of clinical trials10.
Some commonly-used pre-clinical methods to evaluate the effectiveness of novel anti-cancer regimens are: a) measurement of capacity to reduce tumor cell proliferation in vitro (cell proliferation assays), b) therapy-induced reduction in capacity of tumor cells to form tissue culture colonies (colony formation assays), c) therapy-induced reduction in tumor cell metabolic activity in vitro (redox-dye conversion) , d) therapy-induced induction of in vitro tumor cell death (apoptotic, necrotic, autophagic, associated with mitosis and others)11, and e) in vivo therapy-induced reduction of growth or ablation of human and mouse xenografts12-14. 
A major weakness of the listed in vitro methods is that none of them provide continuous real-time evaluation of the effect of candidate therapies. Rather, they provide information only at selected, widely-separated time points during the course of treatment. Such measurements have diminished capacity to accurately reflect the magnitude and timing of tumor cell responses. In vivo mouse xenograft models are also limited by high cost, length of time to complete, and risk of sub-optimal dosing and treatment timing (scheduling). In addition, there is evidence that rodent xenograft models are limited predictors of clinical efficacy in humans, compared to in vitro assessment of responses of primary human tumor cells and established human tumor cell lines to candidate therapeutic interventions15,16. 
We devised a novel combination protocol to evaluate new drug combinations pre-clinically, in a manner that addresses the weaknesses of the more common procedures listed above. In place of proliferation, colony formation, or redox-dye conversion assays, we utilized a metabolism measurement unit to analyze cell adhesion, respiration, and acidification in real time during the entire treatment period17. Simultaneously, we investigated the effects of treatment combination in vivo by using a chicken embryo chorioallantoic membrane (CAM) model of invasion and metastasis18,19. We used these methods to evaluate the ability of an antisense oligonucleotide (ASO) targeting BRCA2 to potentiate the effectiveness of the commonly used chemotherapeutic drug cisplatin.

<table border="0" cellpadding="0" cellspacing="0" >
	<tbody>
		<tr >
			<td >Name of Material/ Equipment</td>
			<td >Company</td>
			<td >Catalog Number</td>
			<td >Comments/Description</td>
		</tr>
		<tr >
			<td >A549 cells</td>
			<td >ATCC</td>
			<td >CCL-185</td>
			<td>http://www.atcc.org/products/all/CCL-185.aspx</td>
		</tr>
		<tr >
			<td >AeraSeal film&#160;</td>
			<td >Carl Roth GmbH</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >AMEM</td>
			<td >Wisent Bioproducts</td>
			<td >210-011-QK</td>
			<td></td>
		</tr>
		<tr >
			<td >Antisense oligodeoxynucleotides</td>
			<td >Avecia</td>
			<td ></td>
			<td>BRCA2 target sequence: 5&#39; - UAAGGAACGUCAAGAGAUAC - 3&#39; (bases 7241-7259 )</td>
		</tr>
		<tr >
			<td >Axio Zoom V16 Microscope</td>
			<td >Carl Zeiss</td>
			<td ></td>
			<td>http://www.zeiss.ca/microscopy/en_ca/products/stereo-zoom-microscopes/axio-zoom-v16.html</td>
		</tr>
		<tr >
			<td >Bionas Biosensor Chips</td>
			<td >Bionas GmbH and Micronas GmbH</td>
			<td >BIS8001D</td>
			<td></td>
		</tr>
		<tr >
			<td >Bionas Discovery 2500 System&#160;</td>
			<td >Bionas GmbH</td>
			<td ></td>
			<td>http://www.bionas-discovery.com/prodservices/instruments/system2500/</td>
		</tr>
		<tr >
			<td >Cisplatin</td>
			<td >Sigma Aldrich</td>
			<td >479306</td>
			<td></td>
		</tr>
		<tr >
			<td >Fertilized chicken eggs</td>
			<td >Sourced locally</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Fetal bovine serum&#160;</td>
			<td >Gibco - Life Technologies</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Lipofectamine 2000&#160;</td>
			<td >Invitrogen - Life Technologies&#160;</td>
			<td >12566014</td>
			<td>http://www.lifetechnologies.com/ca/en/home/life-science/protein-expression-and-analysis/transfection-selection/lipofectamine-2000.html</td>
		</tr>
		<tr >
			<td >PBS</td>
			<td >Wisent Bioproducts</td>
			<td >311-010-CL</td>
			<td></td>
		</tr>
		<tr >
			<td >Trypsin (0.25%)/EDTA</td>
			<td >Wisent Bioproducts</td>
			<td >325-043-CL</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluating the effectiveness of cancer drug sensitization in vitro and in vivo

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same pathway, are likely to fail. Emphasis must be placed upon the inhibition of pathways that are responsible for intrinsic and/or adaptive resistance to therapy. An active field of investigation is the development and testing of DNA repair inhibitors that promote the action of, and prevent resistance to, commonly used chemotherapy and radiotherapy. We used a novel protocol to evaluate the effectiveness of BRCA2 inhibition as a means to sensitize tumor cells to the DNA damaging drug cisplatin. Tumor cell metabolism (acidification and respiration) was monitored in real-time for a period of 72 hr to delineate treatment effectiveness on a minute by minute basis. In combination, we performed an assessment of metastatic frequency using a chicken embryo chorioallantoic membrane (CAM) model of extravasation and invasion. This protocol addresses some of the weaknesses of commonly used in vitro and in vivo methods to evaluate novel cancer therapy regimens. It can be used in addition to common methods such as cell proliferation assays, cell death assays, and in vivo murine xenograft studies, to more closely discriminate amongst candidate targets and agents, and select only the most promising candidates for further development.

Results and figures adapted with permission from published work22.
BRCA2 inhibition induces a decrease in respiration in cisplatin treated tumor cells
Human A549 lung cancer cells treated with BRCA2-targeting ASO and cisplatin exhibited an early and irreversible decrease in respiration, compared to cells which received control ASO and cisplatin alone; after 24 hr of cisplatin treatment the difference in respiration between BRCA2 ASO and control A...

Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics.

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same ...

evaluating-effectiveness-cancer-drug-sensitization-vitro

Research

JoVE Journal

Medicine

8.2K ビュー.  Western University. Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics. 

ビデオ: Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent until many years after removal of the primary tumor and adjuvant therapy. A likely explanation of this phenomenon is that tumor cells have seeded metastatic sites, are resistant to conventional therapies, and remain dormant for long periods of time 1-4.
The existence of dormant cancer cells at secondary sites has been described previously as quiescent solitary cells that neither proliferate nor undergo apoptosis 5-7. Moreover, these solitary cells has been shown to disseminate from the primary tumor at an early stage of disease progression 8-10 and reside growth-arrested in the patients' bone marrow, blood and lymph nodes 1,4,11. Therefore, understanding mechanisms that regulate dormancy or the switch to a proliferative state is critical for discovering novel targets and interventions to prevent disease recurrence. However, unraveling the mechanisms regulating the switch from tumor dormancy to metastatic growth has been hampered by the lack of available model systems.
in vivo and ex vivo model systems to study metastatic progression of tumor cells have been described previously 1,12-14. However these model systems have not provided in real time and in a high throughput manner mechanistic insights into what triggers the emergence of solitary dormant tumor cells to proliferate as metastatic disease. We have recently developed a 3D in vitro system to model the in vivo growth characteristics of cells that exhibit either dormant (D2.OR, MCF7, K7M2-AS.46) or proliferative (D2A1, MDA-MB-231, K7M2) metastatic behavior in vivo . We demonstrated that tumor cells that exhibit dormancy in vivo at a metastatic site remain quiescent when cultured in a 3-dimension (3D) basement membrane extract (BME), whereas cells highly metastatic in vivo readily proliferate in 3D culture after variable, but relatively short periods of quiescence. Importantly by utilizing the 3D in vitro model system we demonstrated for the first time that the ECM composition plays an important role in regulating whether dormant tumor cells will switch to a proliferative state and have confirmed this in in vivo studies15-17. Hence, the model system described in this report provides an in vitro method to model tumor dormancy and study the transition to proliferative growth induced by the microenvironment.

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

A modified 3-D in vitro system is presented in which growth characteristics of several tumor cell lines in reconstituted basement membrane correlate with the dormant or proliferative behavior of the tumor cells at a metastatic secondary site in vivo.

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent ...

Live Imaging of Drug Responses in the Tumor Microenvironment in Mouse Models of Breast Cancer

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional co-culture systems are frequently used to explicate tumor-stroma interactions, including their role in drug responses. However, many of the interactions that occur in vivo in the intact microenvironment cannot be completely replicated in these in vitro settings. Thus, direct visualization of these processes in real-time has become an important tool in understanding tumor responses to therapies and identifying the interactions between cancer cells and the stroma that can influence these responses. Here we provide a method for using spinning disk confocal microscopy of live, anesthetized mice to directly observe drug distribution, cancer cell responses and changes in tumor-stroma interactions following administration of systemic therapy in breast cancer models. We describe procedures for labeling different tumor components, treatment of animals for observing therapeutic responses, and the surgical procedure for exposing tumor tissues for imaging up to 40 hours. The results obtained from this protocol are time-lapse movies, in which such processes as drug infiltration, cancer cell death and stromal cell migration can be evaluated using image analysis software.

We describe a method for imaging response to anti-cancer treatment in vivo and at single cell resolution.

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional ...

Slow-release Drug Delivery through Elvax 40W to the Rat Retina: Implications for the Treatment of Chronic Conditions

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these diseases. Chronic retinal diseases such as retinal oedema or neovascularization usually require multiple intraocular injections to effectively treat the condition. However, the risks associated with these injections increase with repeated delivery of the drug. Therefore, alternative delivery methods need to be established in order to minimize the risks of reinjection. Several other investigations have developed methods to deliver drugs over extended time, through materials capable of releasing chemicals slowly into the eye. In this investigation, we outline the use of Elvax 40W, a copolymer resin, to act as a vehicle for drug delivery to the adult rat retina. The resin is made and loaded with the drug. The drug-resin complex is then implanted into the vitreous cavity, where it will slowly release the drug over time. This method was tested using 2-amino-4-phosphonobutyrate (APB), a glutamate analogue that blocks the light response of the retina. It was demonstrated that the APB was slowly released from the resin, and was able to block the retinal response by 7 days after implantation. This indicates that slow-release drug delivery using this copolymer resin is effective for treating the retina, and could be used therapeutically with further testing.

This paper details how Elvax 40W can be used as a slow-release method for drug delivery to the adult rat retina. The protocol for preparing, loading, and delivering the drug-resin complex to the eye is described.

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these ...

Carotid Artery Infusions for Pharmacokinetic and Pharmacodynamic Analysis of Taxanes in Mice

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study model. As the use of mouse models are often a vital step in preclinical drug discovery and drug development1-8, it is necessary to design a system to introduce drugs into mice in a uniform, reproducible manner. Ideally, the system should permit the collection of blood samples at regular intervals over a set time course. The ability to measure drug concentrations by mass-spectrometry, has allowed investigators to follow the changes in plasma drug levels over time in individual mice1, 9, 10. In this study, paclitaxel was introduced into transgenic mice as a continuous arterial infusion over three hours, while blood samples were simultaneously taken by retro-orbital bleeds at set time points. Carotid artery infusions are a potential alternative to jugular vein infusions, when factors such as mammary tumors or other obstructions make jugular infusions impractical. Using this technique, paclitaxel concentrations in plasma and tissue achieved similar levels as compared to jugular infusion. In this tutorial, we will demonstrate how to successfully catheterize the carotid artery by preparing an optimized catheter for the individual mouse model, then show how to insert and secure the catheter into the mouse carotid artery, thread the end of the catheter out through the back of the mouse&#8217;s neck, and hook the mouse to a pump to deliver a controlled rate of drug influx. Multiple low volume retro-orbital bleeds allow for analysis of plasma drug concentrations over time.

This method was developed with the goal of delivering a steady drug solution via the carotid artery, to assess the pharmacokinetics of novel drugs in mouse models.

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study ...

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of women are alive 5 years after diagnosis. The omentum is a preferred site of HGSC metastasis formation. Despite the clinical importance of this microenvironment, the contribution of omental adipose tissue to ovarian cancer progression remains understudied. Omental adipose is unusual in that it contains structures known as milky spots, which are comprised of B, T, and NK cells, macrophages, and progenitor cells surrounding dense nests of vasculature. Milky spots play a key role in the physiologic functions of the omentum, which are required for peritoneal homeostasis. We have shown that milky spots also promote ovarian cancer metastatic colonization of peritoneal adipose, a key step in the development of peritoneal metastases. Here we describe the approaches we developed to evaluate and quantify milky spots in peritoneal adipose and study their functional contribution to ovarian cancer cell metastatic colonization of omental tissues both in vivo and ex vivo. These approaches are generalizable to additional mouse models and cell lines, thus enabling the study of ovarian cancer metastasis formation from initial localization of cells to milky spot structures to the development of widespread peritoneal metastases.

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

We outline a protocol that implements both in vivo and ex vivo approaches to study ovarian cancer colonization of peritoneal adipose tissues, particularly the omentum. Furthermore, we present a protocol to quantitate and analyze immune cell-structures in the omentum known as milky spots, which promote metastases of peritoneal adipose.

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Depletion of Mouse Cells from Human Tumor Xenografts Significantly Improves Downstream Analysis of Target Cells

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic patient tumors in different assays1. Human tumor xenografts represent the gold standard with respect to tumor biology, drug discovery, and metastasis research 2-4. Tumor xenografts can be derived from different types of material like tumor cell lines, tumor tissue from primary patient tumors4 or serially transplanted tumors. When propagated in vivo, xenografted tissue is infiltrated and vascularized by cells of mouse origin. Multiple factors such as the tumor entity, the origin of xenografted material, growth rate and region of transplantation influence the composition and the amount of mouse cells present in tumor xenografts. However, even when these factors are kept constant, the degree of mouse cell contamination is highly variable.
Contaminating mouse cells significantly impair downstream analyses of human tumor xenografts. As mouse fibroblasts show high plating efficacies and proliferation rates, they tend to overgrow cultures of human tumor cells, especially slowly proliferating subpopulations. Mouse cell derived DNA, mRNA, and protein components can bias downstream gene expression analysis, next-generation sequencing, as well as proteome analysis 5. To overcome these limitations, we have developed a fast and easy method to isolate untouched human tumor cells from xenografted tumor tissue. This procedure is based on the comprehensive depletion of cells of mouse origin by combining automated tissue dissociation with the benchtop tissue dissociator and magnetic cell sorting. Here, we demonstrate that human target cells can be can be obtained with purities higher than 96% within less than 20 min independent of the tumor type.

Human tumor xenografts are vascularized and infiltrated by cells of mouse origin during the growth phase in vivo. To circumvent the bias caused by these contaminating cells during downstream analysis, we developed a method allowing for comprehensive depletion of all mouse cells by magnetic cell sorting.

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant CFTR channel in subjects with cystic fibrosis (CF). Identification of subjects that may benefit from these drugs is challenging because of the extensive heterogeneity of CFTR mutations, as well as other unknown factors that contribute to individual drug efficacy. Here, we describe a simple and relatively rapid assay for measuring individual CFTR function and response to CFTR modulators in vitro. Three dimensional (3D) epithelial organoids are grown from rectal biopsies in standard organoid medium. Once established, the organoids can be bio-banked for future analysis. For the assay, 30-80 organoids are seeded in 96-well plates in basement membrane matrix and are then exposed to drugs. One day later, the organoids are stained with calcein green, and forskolin-induced swelling is monitored by confocal live cell microscopy at 37 &#176;C. Forskolin-induced swelling is fully CFTR-dependent and is sufficiently sensitive and precise to allow for discrimination between the drug responses of individuals with different and even identical CFTR mutations. In vitro swell responses correlate with the clinical response to therapy. This assay provides a cost-effective approach for the identification of drug-responsive individuals, independent of their CFTR mutations. It may also be instrumental in the development of future CFTR modulators.

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

This protocol describes an assay for measuring CFTR function and CFTR modulator responses in cultured tissue from subjects with cystic fibrosis (CF). Biopsy-derived intestinal organoids swell in a cAMP-driven fashion, a response that is defective (or strongly reduced) in CF organoids and can be restored by exposure to CFTR modulators.

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic study in the liver. Here, numerous assays are described to comprehensively measure the phenotype and parameters of hepatic steatosis in mouse and hepatocyte models. 
Combining the physiological, histological, and biochemical methods, this system can be used to assess the progress of hepatic steatosis. In vivo, the measurements of body weight and nuclear magnetic resonance (NMR) provide a general understanding of mice in a non-invasive manner. Hematoxylin and Eosin (H&amp;E) and Oil Red O staining determine the histological morphology and lipid deposition of liver tissue under nutrient overload conditions, such as high-fat diet feeding. Next, the total lipid contents are isolated by chloroform/methanol extraction, which are followed by a biochemical analysis for triglyceride and cholesterol. Moreover, mouse primary hepatocytes are treated with high glucose plus insulin to stimulate lipid accumulation, an efficient in vitro model to mimic diet-induced hyperglycemia and hyperinsulinemia in vivo. Then, the lipid deposition is measured by Oil Red O staining and chloroform/methanol extraction. Oil Red O staining determines intuitive hepatic steatotic phenotypes, while the lipid extraction analysis determines the parameters that can be analyzed statistically. The present protocols are of interest to scientists in the fields of fatty liver diseases, insulin resistance, and type 2 diabetes.

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Here, optimized methods to generate in vivo and in vitro models of hepatic steatosis and to analyze the steatotic phenotypes and related physiological parameters are described.

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Preparation of Herbal Medicine: Er-Xian Decoction and Er-Xian-containing Serum for In Vivo and In Vitro Experiments

Traditional herbal medicine, an alternative medicine in the clinical setting, has received increased attention in recent years. Before delivery to the body, an additional extraction procedure is commonly required to release the active constituents from raw herbs. Water decoction is a classical extraction procedure that is still broadly used in the clinical settings. Here, we propose a detailed protocol for er-xian decoction (EXD) in order to apply herbal decoctions to experimental studies. The calculation of an animal-appropriate dose is described, as well as the four main steps of EXD: soaking, water decoction, filtration, and concentration. In addition, serum-containing EXD is introduced to rats as a means of in vitro validation. Here, rats were orally administered EXD for three days. Blood samples were then collected, inactivated, centrifuged, and filtered. The serum, diluted with the culture medium, can be utilized to treat cells or tissues in vitro. For example, EXD was applied to both in vivo and in vitro studies and demonstrated that EXD enhances osteogenesis. This protocol can be used as a reference for the preparation and application of herbal medicines.

Preparation of Herbal Medicine: Er-Xian Decoction and Er-Xian-containing Serum for In Vivo and In Vitro Experiments

Here, we present the preparation of an er-xian decoction (EXD) in four steps&#8212;soaking, decoction, filtration, and concentration&#8212;and demonstrate the administration of a prepared EXD-containing serum to rats. These methods are applicable to the in vivo and in vitro study of herbal decoctions such as traditional Chinese medicines.

Traditional herbal medicine, an alternative medicine in the clinical setting, has received increased attention in recent years. Before delivery to the ...