We thank Gordon Freeman for providing the anti-PD-L1 blocking antibody. We thank the clinical and laboratory staff at the Massachusetts General Hospital and all study participants for their invaluable role in this project.
This study was supported by the National Institute of Allergy and Infectious Diseases of the National Institutes of Health (PO1 AI-080192; D.E.K), the National Heart Lung and Blood Institute of the National Institutes of Health (RO1 HL-092565; D.E.K). D.E.K is supported by a Research Scholar Career Award of the Quebec Health Research Fund (FRQS). FP is supported by a fellowship grant of the Massachusetts General Hospital Executive Committee on Research and the Harvard Global Health Institute (HGHI).&#160;

1. Depletion and Isolation of PBMCs via Ficoll Separation
<ol>
	<li>Deplete CD8+ T cells by adding Human CD8+ Depletion Cocktail at 50 &#956;l/ml of whole blood.</li>
	<li>Mix well and incubate for 20 min at room temperature (18-25 &#176;C).</li>
	<li>After incubation, mix whole blood with HBSS (Hank&#39;s Balanced Salt Solution without Ca2+ or Mg2+) and layer over Histopaque. Spin at 340 rcf for 30 min (no brake, slow acceleration).</li>
	<li>Collect PBMCs and transfer to a new 50ml conical. Wash 2x with 45 ml RPMI 1640 supplemented with 50 IU Penicillin, 50 &#956;g/ml Streptomycin, 2 mM L-glutamine, and 1% HEPES by spinning for 10 min at 340 rcf.</li>
</ol>
2. Antibody Blockade and Antigen-Specific Stimulation of Cells
<ol>
	<li>Resuspend cells at 2x106 per condition in RPMI 1640 containing 10% Human Serum supplemented with 50 IU Penicillin, 50 &#956;g/ml Streptomycin, 2 mM L-glutamine, and 1% HEPES, accounting for 500 &#956;l per condition.</li>
	<li>Aliquot 500 &#956;l of cell suspension per FACS tube.</li>
	<li>Depending on the pathway investigated, add PD-L1, IL-10R&#945; blocking antibodies and/or isotype controls at 10 &#956;g/ml and incubate for 15 min at 37 &#176;C, 5% CO2.</li>
	<li>Stimulate cells with an HIV-1 Gag peptide pool at 1 &#956;g/ml/peptide final concentration. Also include a &#34;no stimulation&#34; control for each blocking condition. Incubate at 37 &#176;C, 5% CO2 for 48 hr.</li>
</ol>
3. Collection and Analysis of Supernatant
<ol>
	<li>After 48 hr, spin down FACS tubes for 7 min at 340 rcf.</li>
	<li>Carefully collect 2 x 225 &#956;l supernatant in Eppendorf tubes for Luminex bead arrays without disturbing the pellet.</li>
	<li>Inactivate virus in the collected supernatant with 25 &#956;l 0.5% PBS-Tween to give a final concentration of 0.05% PBS-Tween.</li>
	<li>Store collected supernatants that are not immediately used in a -80 &#176;C freezer.</li>
	<li>Measure desired cytokine concentrations using Millipore Luminex kit according to manufacturer&#39;s protocol.</li>
</ol>
4. Collection and Phenotypic Analysis of Cells via Flow Cytometry
<ol>
	<li>After collecting supernatant, wash cells in 3ml PBS. Spin cells for 7 min at 340 rcf and decant excess wash.</li>
	<li>Stain for viability using a LIVE/DEAD Fixable Dead Cell Stain Kit according to manufacturer&#39;s protocol.</li>
	<li>Wash cells in PBS for 7 min at 340 rcf and at 4 &#176;C. Resuspend in 100 &#956;l PBS 1% FBS.</li>
	<li>If staining for monocytes or other antigen presenting cells, block Fc receptors by adding 1.4 &#956;l of FcR blocking reagent and vortex to mix.</li>
	<li>Incubate for 10 min at 4 &#176;C.</li>
	<li>Add surface antibodies, vortex, and incubate for 20 min at 4 &#176;C in the dark.</li>
	<li>Wash cells with PBS 1% FBS, decant excess wash, and add 200 &#956;l 4% paraformaldehyde. Incubate at room temperature&#160;for 20 min in the dark.</li>
	<li>Wash cells with PBS 1% FBS, resuspend in 250 &#956;l PBS 1% FBS, and acquire on a multilaser flow cytometer (e.g.&#160;BD LSRII or Fortessa).</li>
</ol>
5. Analysis of Cells via qRT-PCR
<ol>
	<li>For cells not analyzed via flow cytometry: after supernatant collection, lyse cells in 300 &#956;l Qiagen Buffer RLT containing 1% beta-mercaptoethanol. If not continuing with protocol, cells can be frozen at -80 &#176;C after this point.</li>
	<li>Isolate RNA using an RNA isolation kit following the manufacturer&#39;s protocol.</li>
	<li>Synthesize cDNA from RNA using a cDNA synthesis kit following the manufacturer&#39;s protocol.</li>
	<li>Perform quantitative PCR using SYBR Green technology.</li>
	<li>Create a primer mix for each primer used including housekeeping genes (e.g.&#160;IL-13, IL-10, IFN-&#947;, GAPDH) by adding primers to nuclease-free water to give a final concentration of 10 &#956;M. Keep on ice.</li>
	<li>Create a master mix for each primer by adding 10.5 &#956;l nuclease-free water, 12.5 &#956;l SYBR green, and 1 &#956;l primer mix per plate well. Keep on ice.</li>
	<li>Pipette 24 &#956;l master mix into each well of the plate that will be used.</li>
	<li>Add 1 &#956;l cDNA to each well according to template.</li>
	<li>Cap wells and centrifuge plate for 3 min&#160;at 800 rcf.</li>
	<li>Run plate on a qRT-PCR machine, e.g.&#160;a Stratagene MX3005P instrument.</li>
</ol>
6. Adaptation for Intracellular Cytokine Staining at 48 hr
Add Brefeldin and Monensin 6 hr prior to intracellular cytokine staining. Brefeldin is added at a concentration of 10 &#956;g/ml while Monensin is added according to manufacturer&#39;s instructions. For convenience, Brefeldin can be added 12 hr prior to stain at a concentration of 5 &#956;g/ml.
<ol>
	<li>After surface stain, wash cells with PBS 1% FBS and stain for intracellular cytokines such as IL-12, IFN-&#947;, and TNF-&#945; using a Fixation/Permeabilization Solution kit and protocol.</li>
	<li>Wash cells, resuspend in 250 &#956;l PBS 1% FBS, and run on a multilaser flow cytometer (e.g. BD LSR II or Fortessa).</li>
</ol>
7. Adaptation for Sorting Cells
<ol>
	<li>16 hr after stimulation, stain for viability using LIVE/DEAD Fixable Dead Cell Stain Kit according to manufacturer&#39;s protocol. Keep cells on ice during entire procedure.</li>
	<li>Wash cells with PBS for 7 min at 340 rcf and at 4 &#176;C. Resuspend in 100 &#956;l PBS 1% FBS.</li>
	<li>Add surface antibodies, vortex to mix, and incubate cells on ice in the dark for 20 min.</li>
	<li>Wash cells with PBS 1% FBS at 340 rcf and at 4 &#176;C and resuspend in 500 &#956;l cold RPMI 1640 containing 10% Fetal Bovine Serum supplemented with 50 IU Penicillin, 50 &#956;g/ml Streptomycin, 2 mM L-glutamine, and 1% HEPES.</li>
	<li>Filter cells using 5 ml Polystyrene Round-Bottom Tube with Cell-Strainer cap.</li>
	<li>Prepare collection tubes for sort by adding 200 &#956;l RPMI 1640 containing 10% Fetal Bovine Serum supplemented with 50 IU Penicillin, 50 &#956;g/ml Streptomycin, 2 mM L-glutamine, and 1% HEPES to each tube. Keep all tubes on ice during sort.</li>
	<li>Live sort the cell subsets of interest on an instrument (e.g.&#160;BD FACS Aria II) located in a facility equipped for biohazardous material.</li>
	<li>After cells have been sorted, place cells back in the incubator for desired amount of time and follow with supernatant collection/Luminex analysis and cell pellet collection/PCR analysis.</li>
</ol>

<ol>
	<li>Zajac, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+immune+evasion+due+to+persistence+of+activated+T+cells+without+effector+function.">Viral immune evasion due to persistence of activated T cells without effector function.</a> J. Exp. Med. 188, 2205-2213 (1998).</li><li>Wherry, E. J., Blattman, J. N., Murali-Krishna, K., vander Most, R., Ahmed, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+persistence+alters+CD8+T-cell+immunodominance+and+tissue+distribution+and+results+in+distinct+stages+of+functional+impairment.">Viral persistence alters CD8 T-cell immunodominance and tissue distribution and results in distinct stages of functional impairment.</a> J. Virol. 77, 4911-4927 (2003).</li><li>Kwon, D. S., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+and+detrimental+roles+of+IL-10+in+HIV+pathogenesis.">Protective and detrimental roles of IL-10 in HIV pathogenesis.</a> Eur. Cytokine Netw. 21, 208-214 (2010).</li><li>Porichis, F., Kaufmann, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+PD-1+in+HIV+pathogenesis+and+as+target+for+therapy.">Role of PD-1 in HIV pathogenesis and as target for therapy.</a> Curr. HIV/AIDS Rep. 9, 81-90 (2012).</li><li>Wherry, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+exhaustion.">T cell exhaustion.</a> Nat. 12, 492-499 (2011).</li><li>Trautmann, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upregulation+of+PD-1+expression+on+HIV-specific+CD8++T+cells+leads+to+reversible+immune+dysfunction.">Upregulation of PD-1 expression on HIV-specific CD8+ T cells leads to reversible immune dysfunction.</a> Nat. Med. 12, 1198-1202 (2006).</li><li>Day, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+expression+on+HIV-specific+T+cells+is+associated+with+T-cell+exhaustion+and+disease+progression.">PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression.</a> Nature. 443, 350-354 (2006).</li><li>Brockman, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-10+is+up-regulated+in+multiple+cell+types+during+viremic+HIV+infection+and+reversibly+inhibits+virus-specific+T+cells.">IL-10 is up-regulated in multiple cell types during viremic HIV infection and reversibly inhibits virus-specific T cells.</a> Blood. 114, 346-356 (2009).</li><li>Barber, D. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restoring+function+in+exhausted+CD8+T+cells+during+chronic+viral+infection.">Restoring function in exhausted CD8 T cells during chronic viral infection.</a> Nature. 439, 682-687 (2006).</li><li>Zhang, J. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1+up-regulation+is+correlated+with+HIV-specific+memory+CD8++T-cell+exhaustion+in+typical+progressors+but+not+in+long-term+nonprogressors.">PD-1 up-regulation is correlated with HIV-specific memory CD8+ T-cell exhaustion in typical progressors but not in long-term nonprogressors.</a> Blood. 109, 4671-4678 (2007).</li><li>Ndhlovu, Z. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-dimensional+immunomonitoring+models+of+HIV-1-specific+CD8+T-cell+responses+accurately+identify+subjects+achieving+spontaneous+viral+control.">High-dimensional immunomonitoring models of HIV-1-specific CD8 T-cell responses accurately identify subjects achieving spontaneous viral control.</a> Blood. 121, 801-811 (2013).</li><li>Porichis, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Responsiveness+of+HIV-specific+CD4+T+cells+to+PD-1+blockade.">Responsiveness of HIV-specific CD4 T cells to PD-1 blockade.</a> Blood. 118, 965-974 (2011).</li><li>Kwon, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD4++CD25++regulatory+T+cells+impair+HIV-1-specific+CD4+T+cell+responses+by+upregulating+interleukin-10+production+in+monocytes.">CD4+ CD25+ regulatory T cells impair HIV-1-specific CD4 T cell responses by upregulating interleukin-10 production in monocytes.</a> 86, 6586-6594 (2012).</li></ol>

The authors declare that they have no competing financial interests.

Supernatant collection is an imperative part of this experimental design. When harvesting supernatants for the Luminex assay, aliquots were made and kept at -80 &#176;C to prevent protein degradation due to freeze-thaw cycles. Freezing and thawing can be harsh processes for proteins, and by minimizing freeze-thaws, signal will be maximized in assays. Therefore, it is easier to obtain repeatable and more accurate data when working from aliquots that have been freeze-thawed the same number of times.
<p class="jove_cont...

During persistent viral infections, virus specific-T cells acquire functional defects in a process known as T cell exhaustion. Early in vivo studies in the murine LCMV model of chronic viral infection indicated that exhausted virus-specific T cells have reduced cytolytic function against virally infected cells, lose their ability to proliferate and have reduced capacity to produce cytokines such as IL-2, TNF-&#945; and IFN-&#947;1,2. A complex network of immunoregulatory pathways, such as PD-1 and IL-10, are upregulated during chronic infections and contribute to T cell dysfunction (reviewed in3,4). In vivo administration of blocking antibodies against these inhibitory pathways in the LCMV mouse model restored function of exhausted virus-specific T cells and enhanced viral clearance, indicating that T cell exhaustion is a partially reversible phenomenon (reviewed in 5).
Findings on the LCMV model were quickly extended to human chronic viral infections such as HBV, HCV and HIV5. In chronic HIV-1 infection, PD-1 and IL-10 pathways are upregulated in infected subjects and correlate with parameters of disease progression, directly with the viral load and inversely with the CD4 count6-8. Antibody blockade of the PD-1 or IL-10 pathways in vitro restored proliferation of HIV-specific CD4 and CD8 T cells indicating that, similar to the LCMV mouse model, T cell exhaustion in humans is a partially reversible phenomenon. However, due to the delicate nature of experiments on human samples as well as limitations in the sensitivity of in vitro assays, thorough investigation of the functional restoration profiles achieved by these interventions is strikingly absent. Proliferation assays have been, so far, the only reliable in vitro assay tested in most studies, yet there is a remarkable lack of evidence on the impact of these interventions on: 1) the killing capacity of cytotoxic T cells, 2) the antiviral effect of T cells on viral replication, 3) the cytokine secretion profile, and 4) the effect on CD4 T cell help on other cell subsets.
Intracellular cytokine staining (ICS) is a very useful and widely used flow cytometry based assay that is used to detect production of cytokines in various cell types in both mice and humans. It has also been used to investigate the effect of antibody blockade of inhibitory pathways. In ICS assays, cytokine secretion is blocked by the addition of Brefeldin and/or Monensin. Cytokines trapped inside the cells are then detected with fluorescent antibodies using polychromatic flow cytometry. The duration of the assay is usually limited to 6 or 12 hr after antigen stimulation since both Brefeldin and Monensin, which are typically added within 2 hr&#160;of antigen addition, are toxic to the cells. The ICS assay is a powerful technique that has been useful in the investigation of the effect of in vivo administration of blocking antibody intervention in mice where cells were extracted after a certain period of time after antibody exposure9. However, there are several limitations for the application of this experimental approach to evaluate the impact of blockade of inhibitory receptors in human samples. When performing antibody interventions of inhibitory pathways in a 6 or 12 hr stimulation in vitro (typically the case with human samples), blockade of inhibitory receptors in most cases does not alter the frequency of responding antigen-specific T cells as measured by standard ICS assays6, 7 . Measurements of per-cell cytokine production as measured by mean or median fluorescence intensity have given inconsistent results6, 7, 10. On the other hand, when ICS is performed at a late time point after stimulation (i.e. six days), changes in the number of cytokine-secreting cells can be observed. The differences are a combined effect of altered proliferation, survival, and changes in effector function that accumulate over the specified period of time6. One way to partially overcome these limitations is to incubate for longer periods of time (e.g. 36 hr, 60 hr, etc.) with the antigen before the addition of the cytokine secretion blocker without waiting for proliferation to occur. We have successfully used this method to determine the kinetics of cytokine secretion by HIV-specific CD4 and CD8 T cells11,12; however, this approach is not able to detect small responses and will not give an integrated result of the total cytokine secretion occurring since stimulation. Therefore, ICS is not a sensitive enough method to detect the impact of blockade of inhibitory pathways on the quantity of cytokines produced by activated T cells compared with cytokine mRNA quantitation or measurements of cytokine secretion in the supernatant at the same time points. Additionally, most of the cytokines produced by activated T cells act in autocrine fashion by contributing to either positive or negative feedback loops through interaction with antigen presenting cells. Therefore, addition of Brefeldin or Monensin during the ICS assay prevents cytokine secretion and thus stimulation of T cells is not optimal. Finally, detection of multiple cytokines with ICS is limited by the availability and sensitivity of antibodies for detection of cytokines with flow cytometry as well as by constraints in the number of fluorochromes that can be used simultaneously in any given panel.
We developed a highly sensitive in vitro experimental approach to evaluate the impact of immunoregulatory pathways in regulating cytokine secretion by HIV-specific CD4 T cells and subsequently CD4 help to antigen presenting cells (APCs) and natural killer cells (NK cells). This method can also be used to evaluate the impact of blockade of inhibitory molecules on CD8 T cell function by depleting the CD4 T cells from PBMCs or by stimulating with optimal peptides that are recognized only by CD8 T cells. In contrast to intracellular cytokine staining assays, we decided not to interfere with the cytokine secretion by HIV-specific CD4 T cells in order to be able to: 1) perform a more accurate quantification of the cytokine levels produced; 2) investigate a broader panel of cytokines or effector molecules; and 3) evaluate the impact of cytokines produced by HIV-specific CD4 T cells on other cell subsets. We stimulate CD8 depleted PBMCs with an HIV-1 Gag peptide pool in the presence of blocking antibodies for the immunoregulatory pathway of interest. After the desired time of incubation, usually 48 hr, we collect the supernatants to measure cytokine secretion with bead arrays and collect the cell pellets either for phenotypic analysis of the different cell subsets or for transcriptional analysis. Of note, at this 48 hr time point, we do not detect a significant population of proliferating T cells12. This is a flexible approach and several adaptations of this design can be applied to address different hypotheses. For example, the individual cell subsets (such as HIV-specific CD4 T cells or PD-1 high CD4 T cells, etc.) can be sorted after 12 hr of incubation before further incubation for 36 hr followed by collection of supernatants and cell pellets to investigate more specifically the impact of blockade interventions on cytokine secretion by defined subpopulations of PBMCs.

<table border="1">
		<tbody>
		 <tr>
			<td>Name of Reagent/Material</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		 </tr>
		 <tr>
			<td>Hanks Balanced Salt Solution without Ca2+ or Mg2+</td>
			<td>Sigma</td>
			<td>H9394</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RPMI 1640</td>
			<td>Sigma</td>
			<td>R0883</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Histopaque-1077</td>
			<td>Sigma</td>
			<td>10771</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Human Serum AB</td>
			<td>Gemini BioProducts</td>
			<td>100-512</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Penicillin/Streptomycin</td>
			<td>Mediatech</td>
			<td>30 001 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>L-glutamine</td>
			<td>Mediatech</td>
			<td>25 005 CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>HEPES buffer</td>
			<td>Mediatech</td>
			<td>25060CI</td>
			<td></td>
		 </tr>
		 <tr>
			<td>FcR blocking reagent, human</td>
			<td>Miltenyi</td>
			<td>130-059-901</td>
			<td></td>
		 </tr>
		 <tr>
			<td>RosetteSep Human CD8+ Depletion Cocktail </td>
			<td>Stem Cell </td>
			<td>15663</td>
			<td></td>
		 </tr>
		 <tr>
			<td>LIVE/DEAD Fixable Dead Cell Stain Kit, for UV excitation</td>
			<td>Invitrogen</td>
			<td>L23105</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Rneasy Mini Kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Improm-II Reverse Transcription System</td>
			<td>Promega</td>
			<td>A3800</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Brilliant II SYBR qPCR Low Rox Master Mix</td>
			<td>Agilent</td>
			<td>600830</td>
			<td></td>
		 </tr>
		 <tr>
			<td>BD Cytofix/Cytoperm Fixation/Permeabilization Solution Kit</td>
			<td>BD</td>
			<td>554714</td>
			<td></td>
		 </tr>
		 <tr>
			<td>Tween-20</td>
			<td>Fisher</td>
			<td>BP337100</td>
			<td></td>
		 </tr>
		 <tr>
			<td>IFN-&gamma; primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: CGAGATGACTTCGAAAAGCTGA REV: TCTTCGACCTCGAAACAGCA</td>
		 </tr>
		 <tr>
			<td>GAPDH primer</td>
			<td>Invitrogen</td>
			<td></td>
			<td>FOR: TCATCATCTCTGCCCCCTCT REV: AGTGATGGCATGGACTGTGG</td>
		 </tr>
		</tbody>
 </table>

in vitro assay to evaluate the impact of immunoregulatory pathways on hiv-specific cd4 t cell effector function

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are upregulated upon this ongoing antigen exposure and contribute to loss of proliferation, reduced cytolytic function, and impaired cytokine production by CD4 and CD8 T cells. In the murine model of LCMV infection, administration of blocking antibodies against these two pathways augmented T cell responses. However, there is currently no in vitro assay to measure the impact of such blockade on cytokine secretion in cells from human samples. Our protocol and experimental approach enable us to accurately and efficiently quantify the restoration of cytokine production by HIV-specific CD4 T cells from HIV infected subjects.
Here, we depict an in vitro experimental design that enables measurements of cytokine secretion by HIV-specific CD4 T cells and their impact on other cell subsets. CD8 T cells were depleted from whole blood and remaining PBMCs were isolated via Ficoll separation method. CD8-depleted PBMCs were then incubated with blocking antibodies against PD-L1 and/or IL-10R&#945; and, after stimulation with an HIV-1 Gag peptide pool, cells were incubated at 37 &#176;C, 5% CO2. After 48 hr, supernatant was collected for cytokine analysis by beads arrays and cell pellets were collected for either phenotypic analysis using flow cytometry or transcriptional analysis using qRT-PCR. For more detailed analysis, different cell populations were obtained by selective subset depletion from PBMCs or by sorting using flow cytometry before being assessed in the same assays. These methods provide a highly sensitive and specific approach to determine the modulation of cytokine production by antigen-specific T-helper cells and to determine functional interactions between different populations of immune cells.

When performing cytokine measurements using this in vitro system, it is essential to be able to distinguish the antigen-specific responses compared to the no stimulation control. In general, we considered positive responses as any values of the antigenic stimulation that give at least three-fold increase in cytokine levels compared to the no stimulation control and which were within the linear range of the assay. We are using high sensitivity bead array assays that can detect concentrations of cytokines as low a...

Watch this Scientific Journal Video about In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function at JoVE.com

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

We developed an in vitro assay to investigate the role of immunoregulatory pathways in the regulation of cytokine secretion by HIV-specific CD4 T cells.

In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are ...

in-vitro-assay-to-evaluate-impact-immunoregulatory-pathways-on-hiv

Research

JoVE Journal

Immunology and Infection

14.0K 조회수.  The Ragon Institute of MGH, MIT and Harvard.  우리는 HIV 특정 CD4 T 세포에 의한 사이토 카인 분비의 조절에 면역 경로의 역할을 조사하기 위해 시험 관내 분석을 개발 하였다. 

비디오: In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Isolation and Th17 Differentiation of Na&iuml;ve CD4 T Lymphocytes

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets including Th1, Th2, and regulatory T cells. Th17 cells have emerged as a central culprit in overzealous inflammatory immune responses associated with many autoimmune disorders. In this method we purify T lymphocytes from the spleen and lymph nodes of C57BL/6 mice, and stimulate purified CD4+ T cells under control and Th17-inducing environments. The Th17-inducing environment includes stimulation in the presence of anti-CD3 and anti-CD28 antibodies, IL-6, and TGF-&#946;. After incubation for at least 72 hours and for up to five days at 37 &#176;C, cells are subsequently analyzed for the capability to produce IL-17 through flow cytometry, qPCR, and ELISAs. Th17 differentiated CD4+CD25- T cells can be utilized to further elucidate the role that Th17 cells play in the onset and progression of autoimmunity and host defense. Moreover, Th17 differentiation of CD4+CD25- lymphocytes from distinct murine knockout/disease models can contribute to our understanding of cell fate plasticity.

Isolation and Th17 Differentiation of Na&amp;#239;ve CD4 T Lymphocytes

With effector functions distinct from other T cell subsets, Th17 cells have been centrally implicated in inflammatory autoimmunity. This in vitro Th17 differentiation protocol provides a means to determine whether na&#239;ve CD4+ T lymphocytes can differentiate into Th17 cells, and to further examine their role in autoimmunity and host response.

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets ...

Transplantation of Tail Skin to Study Allogeneic CD4 T Cell Responses in Mice

The study of T cell responses and their consequences during allo-antigen recognition requires a model that enables one to distinguish between donor and host T cells, to easily monitor the graft, and to adapt the system in order to answer different immunological questions. Medawar and colleagues established allogeneic tail-skin transplantation in mice in 1955. Since then, the skin transplantation model has been continuously modified and adapted to answer specific questions. The use of tail-skin renders this model easy to score for graft rejection, requires neither extensive preparation nor deep anesthesia, is applicable to animals of all genetic background, discourages ischemic necrosis, and permits chemical and biological intervention. 
In general, both CD4+ and CD8+ allogeneic T cells are responsible for the rejection of allografts since they recognize mismatched major histocompatibility antigens from different mouse strains. Several models have been described for activating allogeneic T cells in skin-transplanted mice. The identification of major histocompatibility complex (MHC) class I and II molecules in different mouse strains including C57BL/6 mice was an important step toward understanding and studying T cell-mediated alloresponses. In the tail-skin transplantation model described here, a three-point mutation (I-Abm12) in the antigen-presenting groove of the MHC-class II (I-Ab) molecule is sufficient to induce strong allogeneic CD4+ T cell activation in C57BL/6 mice. Skin grafts from I-Abm12 mice on C57BL/6 mice are rejected within 12-15 days, while syngeneic grafts are accepted for up to 100 days. The absence of T cells (CD3-/- and Rag2-/- mice) allows skin graft acceptance up to 100 days, which can be overcome by transferring 2 x 104 wild type or transgenic T cells. Adoptively transferred T cells proliferate and produce IFN-&#947; in I-Abm12-transplanted Rag2-/- mice.

Tail-skin transplantation is a powerful model for studying T cell-dependent rejection and tolerance induction during allogeneic immune responses in mice. The advantages of this protocol are minor invasive surgery, and ease of monitoring with no need to sacrifice the recipient mouse.

The study of T cell responses and their consequences during allo-antigen recognition requires a model that enables one to distinguish between donor and ...

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

Granulocytes play a key role in the body&#8217;s innate immune response to bacterial and viral infections. While methods exist to measure granulocyte function, in general these are limited in terms of the information they can provide. For example, most existing assays merely provide a percentage of how many granulocytes are activated following a single, fixed length incubation. Complicating matters, most assays focus on only one aspect of function due to limitations in detection technology. This report demonstrates a technique for simultaneous measurement of granulocyte phagocytosis of bacteria and oxidative burst. By measuring both of these functions at the same time, three unique phenotypes of activated granulocytes were identified: 1) Low Activation (minimal phagocytosis, no oxidative burst), 2) Moderate Activation (moderate phagocytosis, some oxidative burst, but no co-localization of the two functional events), and 3) High Activation (high phagocytosis, high oxidative burst, co-localization of phagocytosis and oxidative burst). A fourth population that consisted of inactivated granulocytes was also identified. Using assay incubations of 10, 20, and 40-min the effect of assay incubation duration on the redistribution of activated granulocyte phenotypes was assessed. A fourth incubation was completed on ice as a control. By using serial time incubations, the assay may be able to able to detect how a treatment spatially affects granulocyte function. All samples were measured using an image-based flow cytometer equipped with a quantitative imaging (QI) option, autosampler, and multiple lasers (488, 642, and 785 nm).

Image-based Flow Cytometry Technique to Evaluate Changes in Granulocyte Function In Vitro

This method demonstrates a technique for assessing granulocyte function by simultaneously measuring phagocytosis of bacteria and oxidative burst. Image-based flow cytometry allowed for the identification of three distinct subsets of activated granulocytes that all differed in their relative functional capacity.

Granulocytes play a key role in the body&#8217;s innate immune response to bacterial and viral infections. While methods exist to measure granulocyte ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages and disadvantages. We describe here an experimental colitis model that is initiated by adoptive transfer of syngeneic splenic CD4+CD45RBhigh T cells into T and B cell deficient recipient mice. The CD4+CD45RBhigh T cell population that largely consists of na&#239;ve effector cells is capable of inducing chronic intestinal inflammation, closely resembling key aspects of human IBD. This method can be manipulated to study aspects of disease onset and progression. Additionally it can be used to study the function of innate, adaptive, and regulatory immune cell populations, and the role of environmental exposures, i.e., the microbiota, in intestinal inflammation. In this article we illustrate the methodology for inducing colitis with a step-by-step protocol. This includes a video demonstration of key technical aspects required to successfully develop this murine model of experimental colitis for research purposes.

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Here, we present a protocol to induce colonic inflammation in mice by adoptive transfer of syngeneic CD4+CD45RBhigh T cells into T and B cell deficient recipients. Clinical and histopathological features mimic human inflammatory bowel diseases. This method allows the study of the initiation of colonic inflammation and progression of disease.

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Mouse Na&#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition of cognate antigen presented on MHC class II. The cytokine signals present in the environment at the time of TCR activation are a major factor in determining the effector fate of a na&#239;ve CD4+ T cell. Although the cytokine environment during na&#239;ve T cell activation may be complex and involve both redundant and opposing signals in vivo, the addition of various cytokine combinations during naive CD4+ T cell activation in vitro can readily promote the establishment of effector T helper lineages with hallmark cytokine and transcription factor expression. Such differentiation experiments are commonly used as a first step for the evaluation of targets believed to promote or inhibit the development of certain CD4+ T helper subsets. The addition of mediators, such as signaling agonists, antagonists, or other cytokines, during the differentiation process can also be used to study the influence of a particular target on T cell differentiation. Here, we describe a basic protocol for the isolation of na&#239;ve T cells from mouse and the subsequent steps necessary for polarizing na&#239;ve cells to various T helper effector lineages in vitro.

Mouse Na&amp;#239;ve CD4+ T Cell Isolation and In vitro Differentiation into T Cell Subsets

Na&#239;ve CD4+ T cells polarize to various subsets depending on the environment at the time of activation. The differentiation of na&#239;ve CD4+ T cells to various effector subsets can be achieved in vitro through the addition of T cell receptor stimuli and specific cytokine signals.

Antigen inexperienced (na&#239;ve) CD4+ T cells undergo expansion and differentiation to effector subsets at the time of T cell receptor (TCR) recognition ...

Application of Long-term cultured Interferon-&#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is controlled up to 95 % of the T cells generated during the expansion phase are eliminated (i.e., contraction phase) and memory T cells remain, sometimes for a lifetime. In humans, two functionally distinct subsets of memory T cells have been described based on the expression of lymph node homing receptors. Central memory T cells express C-C chemokine receptor 7 and CD45RO and are mainly located in T-cell areas of secondary lymphoid organs. Effector memory T cells express CD45RO, lack CCR7 and display receptors associated with lymphocyte homing to peripheral or inflamed tissues. Effector T cells do not express either CCR7 or CD45RO but upon encounter with antigen produce effector cytokines, such as interferon-&#947;. Interferon-&#947; release assays are used for the diagnosis of bovine and human tuberculosis and detect primarily effector and effector memory T cell responses. Central memory T cell responses by CD4+ T cells to vaccination, on the other hand, may be used to predict vaccine efficacy, as demonstrated with simian immunodeficiency virus infection of non-human primates, tuberculosis in mice, and malaria in humans. Several studies with mice and humans as well as unpublished data on cattle, have demonstrated that interferon-&#947; ELISPOT assays measure central memory T cell responses. With this assay, peripheral blood mononuclear cells are cultured in decreasing concentration of antigen for 10 to 14 days (long-term culture), allowing effector responses to peak and wane; facilitating central memory T cells to differentiate and expand within the culture.

Application of Long-term cultured Interferon-&amp;#947; Enzyme-linked Immunospot Assay for Assessing Effector and Memory T Cell Responses in Cattle

Long-term cultured interferon-&#947; enzyme-linked immunospot assay is used as a measure of central memory responses and correlates with protective anti-mycobacterial vaccine responses. With this assay, peripheral blood mononuclear cells are stimulated with mycobacterial antigens and interleukin-2 for 14 days, enabling differentiation and expansion of central memory T cells.

Effector and memory T cells are generated through developmental programing of na&#239;ve cells following antigen recognition. If the infection is ...

Imaging CD4 T Cell Interstitial Migration in the Inflamed Dermis

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral tissues through an as-yet undefined mechanism. The application of multiphoton microscopy to the study of the immune system provides a tool to measure the dynamics of immune responses within intact tissues. Here we present a protocol for non-invasive intravital multiphoton imaging of CD4 T cells in the inflamed mouse ear dermis. Use of a custom imaging platform and a venous catheter allows for the visualization of CD4 T cell dynamics in the dermal interstitium, with the ability to interrogate these cells in real-time via the addition of blocking antibodies to key molecular components involved in motility. This system provides advantages over both in vitro models and surgically invasive imaging procedures. Understanding the pathways used by CD4 T cells for motility may ultimately provide insight into the basic function of CD4 T cells as well as the pathogenesis of both autoimmune diseases and pathology from chronic infections.

The mechanisms that govern the interstitial motility of CD4 effector T cells at sites of inflammation are relatively unknown. We present a non-invasive approach to visualize and manipulate in vitro-primed CD4 T cells in the inflamed ear dermis, allowing for study of the dynamic behavior of these cells in situ.

The ability of CD4 T cells to carry out effector functions is dependent upon the rapid and efficient migration of these cells in inflamed peripheral ...

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal model experimental autoimmune encephalomyelitis (EAE). This process is characterized by the transmigration of activated T cells across brain endothelial cells (ECs), the main constituents of the BBB. However, the consequences on brain EC function upon interaction with such T cells are largely unknown. Here we describe an assay that allows for the evaluation of primary mouse brain microvascular EC (MBMEC) function and barrier integrity during the interaction with T cells over time. The assay makes use of impedance cell spectroscopy, a powerful tool for studying EC monolayer integrity and permeability, by measuring changes in transendothelial electrical resistance (TEER) and cell layer capacitance (Ccl). In direct contact with ECs, stimulated but not na&#239;ve T cells are capable of inducing EC monolayer dysfunction, as visualized by a decrease in TEER and an increase in Ccl. The assay records changes in EC monolayer integrity in a continuous and automated fashion. It is sensitive enough to distinguish between different strengths of stimuli and levels of T cell activation and it enables the investigation of the consequences of a targeted modulation of T cell-EC interaction using a wide range of substances such as antibodies, pharmacological reagents and cytokines. The technique can also be used as a quality control for EC integrity in in vitro T-cell transmigration assays. These applications make it a versatile tool for studying BBB properties under physiological and pathophysiological conditions.

An In Vitro Model of the Blood-brain Barrier Using Impedance Spectroscopy: A Focus on T Cell-endothelial Cell Interaction

Here, we describe an in vitro murine model of the blood-brain barrier that makes use of impedance cell spectroscopy, with a focus on the consequences on endothelial cell integrity and permeability upon interaction with activated T cells.

Breakdown of the blood-brain barrier (BBB) is a critical step in the development of autoimmune diseases such as multiple sclerosis (MS) and its animal ...

Assessing Retinal Microglial Phagocytic Function In Vivo Using a Flow Cytometry-based Assay

Microglia are the tissue resident macrophages of the central nervous system (CNS) and they perform a variety of functions that support CNS homeostasis, including phagocytosis of damaged synapses or cells, debris, and/or invading pathogens. Impaired phagocytic function has been implicated in the pathogenesis of diseases such as Alzheimer's and age-related macular degeneration, where amyloid-&#946; plaque and drusen accumulate, respectively. Despite its importance, microglial phagocytosis has been challenging to assess in vivo. Here, we describe a simple, yet robust, technique for precisely monitoring and quantifying the in vivo phagocytic potential of retinal microglia. Previous methods have relied on immunohistochemical staining and imaging techniques. Our method uses flow cytometry to measure microglial uptake of fluorescently labeled particles after intravitreal delivery to the eye in live rodents. This method replaces conventional practices that involve laborious tissue sectioning, immunostaining, and imaging, allowing for more precise quantification of microglia phagocytic function in just under six hours. This procedure can also be adapted to test how various compounds alter microglial phagocytosis in physiological settings. While this technique was developed in the eye, its use is not limited to vision research.

Assessing Retinal Microglial Phagocytic Function In Vivo Using a Flow Cytometry-based Assay

Microglial phagocytosis is critical for the maintenance of tissue homeostasis and inadequate phagocytic function has been implicated in pathology. However, assessing microglia function in vivo is technically challenging. We have developed a simple but robust technique for precisely monitoring and quantifying the phagocytic potential of microglia in a physiological setting.

Microglia are the tissue resident macrophages of the central nervous system (CNS) and they perform a variety of functions that support CNS homeostasis, ...

In Vitro Differentiation of Human CD4+FOXP3+ Induced Regulatory T Cells (iTregs) from Na&#239;ve CD4+ T Cells Using a TGF-&#946;-containing Protocol

Regulatory T cells (Tregs) are an integral part of peripheral tolerance, suppressing immune reactions against self-structures and thus preventing autoimmune diseases. Clinical approaches to adoptively transfer Tregs, or to deplete Tregs in cancer, are underway with promising first outcomes. 
Because the number of naturally occurring Tregs (nTregs) is very limited, studying certain Treg features using in vitro induced Tregs (iTregs) can be advantageous. To date, the best although not absolutely specific protein marker to delineate Tregs is the transcription factor FOXP3. Despite the importance of Tregs including non-redundant roles of peripherally induced Tregs, the protocols to generate iTregs are currently controversial, particularly for human cells. This protocol therefore describes the in vitro differentiation of human CD4+FOXP3+ iTregs from human na&#239;ve T cells using a range of Treg-inducing factors (TGF-&#946; plus IL-2 only, or their combination with retinoic acid, rapamycin or butyrate) in parallel. It also describes the phenotyping of these cells by flow cytometry and qRT-PCR. 
These protocols result in reproducible expression of FOXP3 and other Treg signature genes and enable the study of general FOXP3-regulatory mechanisms as well as protocol-specific effects to delineate the impact of certain factors. iTregs can be utilized to study various phenotypic aspects as well as molecular mechanisms of Treg induction. Detailed molecular studies are facilitated by relatively large cell numbers that can be obtained. 
A limitation for the application of iTregs is the relative instability of FOXP3 expression in these cells compared to nTregs. iTregs generated by these protocols can also be used for functional assays such as studying their suppressive function, in which iTregs induced by TGF-&#946; plus retinoic acid and rapamycin display superior suppressive activity. However, the suppressive capacity of iTregs can differ from nTregs and the use of appropriate controls is crucial.

&lt;em&gt;In Vitro&lt;/em&gt; Differentiation of Human CD4&lt;sup&gt;+&lt;/sup&gt;FOXP3&lt;sup&gt;+&lt;/sup&gt; Induced Regulatory T Cells (iTregs) from Na&amp;#239;ve CD4&lt;sup&gt;+&lt;/sup&gt; T Cells Using a TGF-&amp;#946;-containing Protocol

This protocol describes the reproducible generation and phenotyping of human induced regulatory T cells (iTregs) from na&#239;ve CD4+ T cells in vitro. Different protocols for FOXP3 induction allow for the study of specific iTreg phenotypes obtained with respective protocols.