This work was supported by grants from CONACyT-SEP (SEP-2008-84582; CB-2011-01-168497) and Promep-SEP for R.A.G.; P.H. received a scholarship from CONACyT (447442).

1. HFF Cell Culture and Ad-infection
<ol>
	<li>Propagate Ad5 WT virus in monolayers of HEK-293 cells and titer as fluorescent forming units (FFU) on HFF cells as described previously8.</li>
	<li>Grow Human Foreskin fibroblasts (HFF) in 10 ml of DMEM/10% Fetal Bovine Serum (FBS) in sterile culture 100 mm dishes at 37 &#186;C and 5% CO2 in a humidified incubator. Determine the cell number using a Neubauer chamber by counting cells in the four 16-square sets. The cell number per ml is obtained by calculating the average number of cells in the four 16-square sets and multiplying this number by 104. For each time post-infection included in step 1.3, use 1 x 107 HFF cells.</li>
	<li>Mock-infect or infect HFF cells with adenovirus type 5 (Ad5) wild-type (WT) (H5pg41008) in 100 mm tissue culture dishes using 1 ml of Ad5 in DMEM per dish at an MOI of 30 Focus Forming Unit, or FFU, per cell. Incubate for 2 hr in a humidified cell culture incubator at 37 &#186;C and 5% CO2, carefully rocking the dishes every 15 min to ensure homogeneous distribution of the virus inoculum over the cells. After this time, remove the medium and add fresh DMEM supplemented with 10% FBS and incubate for 16, 24 or 36 hr in a humidified cell culture incubator at 37 &#186;C and 5% CO2. Proceed to step 2.1.</li>
</ol>
2. Preparation of Sub-nuclear Fractions Enriched with Adenovirus RC
<ol>
	<li>Harvest Ad5-infected or mock-infected HFF cells with a cell scrapper and collect the cells in sterile centrifuge tubes. Determine the cell number as in step 1.2. Use 1 x 107 cells for each time post-infection specified in step 1.3.</li>
	<li>Centrifuge the cells at 220 x g, 4 &#186;C for 5 min.</li>
	<li>Resuspend the cell pellet in ice-cold PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4). Wash cell pellets 3 times using 5 ml of ice-cold PBS per wash. For this purpose, centrifuge the cells at 220 x g, 4 &#186;C for 5 min, decant and discard the supernatant (SN), and resuspend the cell pellet by gentle pipetting.</li>
	<li>To disrupt the plasma membrane, resuspend the cell pellet in 700 &#181;l of ice-cold hypotonic buffer (10 mM HEPES pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.5 mM DTT, 20 &#181;g/ml phenylmethylsulfonyl fluoride (PMSF), a mixture of cysteine, serine, threonine and aspartyl protease inhibitors including 10 &#181;g/ml bovine pancreatic trypsin inhibitor, 10 &#181;g/ml pepstatin A and 10 &#181;g/ml N-acetyl-L-leucyl-L-leucyl-L-argininal) and let the cells swell on ice for 3 hr.</li>
	<li>Lyse the cells using a homogenizer with a loose-fitting A type teflon pestle. Perform 80 dounce strokes and monitor samples every 20 strokes by bright field microscopy to ensure that all cells have been lysed, but that nuclei have not been damaged or ruptured.</li>
	<li>Centrifuge the cell homogenate at 300 x g, 4 &#186;C for 5 min. Store the SN as the cytoplasmic fraction at -20 &#186;C in a centrifuge tube.</li>
	<li>To remove cellular debris from nuclei, resuspend the pellet in 750 &#181;l of solution 1 (S1) (0.25 M sucrose, 10 mM MgCl2 20 &#181;g/ml PMSF, a mixture of cysteine, serine, threonine and aspartyl protease inhibitors including 10 &#181;g/ml bovine pancreatic trypsin inhibitor, 10 &#181;g/ml pepstatin A and 10 &#181;g/ml N-acetyl-L-leucyl-L-leucyl-L-argininal) and layer over an equal volume of solution 2 (S2) (0.35 M sucrose, 0.5 mM MgCl2, 20 &#181;g/ml PMSF, a mixture of cysteine, serine, threonine and aspartyl protease inhibitors including 10 &#181;g/ml bovine pancreatic trypsin inhibitor, 10 &#181;g/ml pepstatin A and 10 &#181;g/ml N-acetyl-L-leucyl-L-leucyl-L-argininal). Centrifuge at 1,400 x g, 4 &#186;C for 5 min.</li>
	<li>Discard the SN using a micropipette. Avoid disturbing the pellet.</li>
	<li>Resuspend the pellet containing isolated nuclei in 750 &#181;l of S2.</li>
	<li>To isolate subnuclear fractions enriched with adenovirus RC (RCf), sonicate resuspended nuclei with an ultrasonic bath, using two 5 min pulses, or until all nuclei are lysed as observed by bright field microscopy. Use ice in ultrasonic bath as needed to keep samples at or below 4 &#176;C.</li>
	<li>Layer the sonicated nuclei over an equal volume of solution 3 (S3) (0.88 M sucrose, 0.5 mM MgCl2) and centrifuge at 3,000 x g, 4 &#186;C for 10 min. Store the 1.5 ml supernatant as the nucleoplasmic fraction (Npl) at -70 &#186;C. Resuspend the pellet in 700 &#181;l of S2 and store as RCf at -70 &#186;C.</li>
</ol>
3. Western Blot Analyses of RCf

NOTE: For Western Blot analysis of Npl and RCf fractions set aside 640 &#181;l for Npl and 300 &#181;l for RCf from the total volume obtained in step 2.11.

<ol>
	<li>Mix 15 &#181;l of each subnuclear fraction in Laemmli buffer 2x (4% SDS, 20% glycerol, 10% 2-mercaptoethanol, 0.004% bromophenol blue, 0.125 M Tris HCl pH 6.8) and boil at 95 &#186;C for 5 min. Load the samples in a 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) denaturing gel and separate proteins for 1.5 hr, at 20 milliamperes (mA).</li>
	<li>Transfer proteins by electroblotting for 1.5 hr at 400 mA onto polyvinylidene difluoride (PVDF) membranes.</li>
	<li>Block membrane for 2 hr at RT using 3% nonfat dry milk in PBS.</li>
	<li>Incubate O/N&#160;at 4 &#186;C with primary antibody against viral E2A DNA-binding protein (B6-89) at a 1:500 dilution in PBS/0.3% nonfat dry milk.</li>
	<li>Wash membrane 3 times with PBS/0.1% Tween 20 for 10 min.</li>
	<li>Incubate the membrane with mouse anti IgG secondary antibody coupled to horse-radish peroxidase (HRP) at a 1:10,000 dilution in PBS for 2 hr at RT.</li>
	<li>Wash the membrane 3 times with PBS/0.1% Tween 20 for 10 min.</li>
	<li>Develop the membrane using enhanced chemiluminescence and X-ray films.</li>
</ol>
4. Viral DNA Detection in RCf
NOTE: For DNA isolation from both Npl and RCf fractions, use 210 &#181;l for Npl and 100 &#181;l for RCf of the total volume obtained in step 2.11.
<ol>
	<li>Incubate sub-nuclear fractions for 1 hr at 55 &#186;C with 1 mg/ml of proteinase K and 0.5% Tween 20.</li>
	<li>Inactivate proteinase K by incubating the samples for 10 min at 95 &#176;C.</li>
	<li>Centrifuge the samples at 20,000 x g, at RT for 2 min.</li>
	<li>Collect the SN. Precipitate the DNA with 1/10 volume of 3M sodium acetate and one volume of isopropanol, O/N&#160;at 4 &#176;C.</li>
	<li>Centrifuge the samples at 20,000 x g, at RT for 10 min.</li>
	<li>Discard the SN using a micropipette. Wash the pellet with 70% ethanol and centrifuge at 20,000 x g, 4 &#176;C for 5 min.</li>
	<li>Resuspend the DNA in 10 &#181;l of 10 mM Tris-HCl pH 7.4</li>
	<li>Quantify DNA using a spectrophotometer by measuring the optical density (OD) at 260 nm.</li>
	<li>To amplify viral DNA, use 100 ng of DNA from each subnuclear fraction in a standard PCR reaction using Taq DNA polymerase in 25 &#181;l of reaction volume with primers that allow the amplification of a region within the Major Late transcription unit, from nucleotide 7273 to nucleotide 7353 (81 bp) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). Use the following cycle conditions: Initial denaturation for 3 min at 95 &#186;C, followed by 20 cycles of amplification (1 min at 95 &#186;C, annealing for 1 min at 62 &#186;C and extension for 30 sec at 72 &#186;C) and a final extension step for 3 min at 72 &#186;C.</li>
	<li>Run the PCR product in 2% agarose gels, at 90 V. Stain with ethidium bromide at 0.5 &#181;g/ml final concentration and visualize DNA to corroborate viral DNA enrichment in the RCf. Handle ethidium bromide with extreme caution and always make sure to wear gloves, as this compound is a potent mutagen. Dispose ethidium bromide according to institutional guidelines.</li>
</ol>
5. Late Viral mRNA Detection in RCf
NOTE: For RNA isolation from both Npl and RCf fractions, use 640 &#181;l for Npl and 300 &#181;l for RCf from the total volume obtained in step 2.11.
<ol>
	<li>Isolate RNA from subnuclear fractions using Trizol according with the manufacturer&#8217;s instructions. Resuspend the RNA in 50 &#181;l of DEPC (diethilpyrocarbonate)-treated water.</li>
	<li>Quantify the RNA using a spectrophotometer to measure the OD at 260 nm (approximately 3 &#181;g are obtained). Store the RNA in 50 ng/&#181;l aliquots at -70 &#186;C.</li>
	<li>Check purified RNA for the absence of DNA contamination by performing a control PCR reaction in the absence of reverse transcriptase (RT), using 5 ng of total RNA and the cycle conditions described in step 4.9.
	<ol>
		<li>If DNA contamination is absent no amplicon should be produced. If DNA contamination is present, incubate the samples with 10 U DNase I, 10 U of Rnase inhibitor, 0.1 M Tris-HCl pH 8.3, 0.5 M KCl and 15 mM MgCl2 for 30 min at 37 &#186;C. Proceed to re-isolate RNA as in step 5.1.</li>
	</ol>
	</li>
	<li>To analyze viral mRNA associated to RCf, amplify 100 ng of RNA from each subnuclear fraction by RT-PCR using primers designed to detect adenoviral late mRNA from different gene families (Table 1).
	<ol>
		<li>For reverse transcription (RT), use 100 ng of RNA, from each subnuclear fraction in a standard RT reaction using M-MuLV RT enzyme in 20 &#181;l of reaction volume for 1 hr at 42 &#186;C and 10 min at 70 &#186;C.</li>
		<li>For amplification, use 1 &#181;l of the cDNA in PCR reactions, as in step 4.9. Use the following cycle conditions: Initial denaturation for 3 min at 95 &#186;C, followed by 25 cycles of amplification (1 min at 95 &#186;C, annealing for 1 min at the temperature specified in Table 1 and extension for 30 sec at 72 &#186;C) and a final extension step for 3 min at 72 &#186;C.</li>
	</ol>
	</li>
	<li>Run the RT-PCR products in 2% agarose gels, at 90 V. Stain gels with ethidium bromide at 0.5 &#181;g/ml final concentration and visualize to corroborate viral late mRNA association to the RCf. Handle ethidium bromide as indicated in step 4.10.</li>
</ol>
6. Immunofluorescence Visualization of RCf
NOTE: Carry-out this procedure under a laminar flow cabinet to avoid contamination of the samples with any dust particles, and filter all solutions before use.
<ol>
	<li>Spot 5 &#181;l of the RCf fraction obtained in step 2.10 directly on a silane-coated slide.</li>
	<li>Let the spot dry for about 5 min at RT.</li>
	<li>Re-hydrate by slowly and indirectly pipetting 500 &#181;l of PBS in a drop beside the RCf spot and letting it flow by tilting the slide. Drain off the excess PBS from the side.</li>
	<li>Block by covering the sample with 500 &#181;l of PBS/5% bovine serum albumin (BSA) for 2 hr at RT.</li>
	<li>Wash the slide 3 times by gently and indirectly pipetting 500 &#181;l of PBS onto the sample. Tilt the slide to drain off the excess PBS.</li>
	<li>Incubate the sample with primary antibody against viral E2A DNA-binding protein (B6-89) at a 1:500 dilution in PBS for 2 hr at RT. Cover the spotted sample with 20 &#181;l of the antibody solution and incubate in a humid chamber to avoid drying.</li>
	<li>Wash the sample 3 times with PBS/0.02% Tween 20 by gently and indirectly pipetting 500 &#181;l of PBS onto the sample. Tilt the slide to drain off the excess wash solution.</li>
	<li>Incubate the samples with mouse anti IgG secondary antibody coupled to a fluorophore that is excited at 488 nm at a 1:2,000 dilution in PBS, for 1 hr at 4 &#186;C. Cover the spotted sample with 20 &#181;l of the antibody solution and incubate in a humid chamber to avoid drying.</li>
	<li>Wash the sample 3 times with PBS/0.02% Tween 20 by gently and indirectly pipetting 500 &#181;l of PBS onto the sample. Tilt the slide to drain off the excess wash solution.</li>
	<li>Cover the spotted sample on the slide with a coverslip using 2 &#181;l PBS/10% glycerol as mounting medium. Seal with clear nail polish and store al -20 &#186;C.</li>
	<li>Analyze the samples using a fluorescence microscope, with a 63x objective and a 1.4 Numeric Aperture (NA) at a wavelength of 488 nm.</li>
</ol>

<ol>
	<li>Doucas, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+replication+is+coupled+with+the+dynamic+properties+of+the+PML+nuclear+structure.">Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure.</a> Genes &#38; Dev. 10, 196-207 (1996).</li><li>Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+virus+replication+compartments.">DNA virus replication compartments.</a> J. Virol. 88, 1404-1420 (2014).</li><li>Boon, J. A., Diaz, A., Ahlquist, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+viral+replication+complexes.">Cytoplasmic viral replication complexes.</a> Cell host microbe. 8, 77-85 (2010).</li><li>Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphological+and+biochemical+characterization+of+the+membranous+hepatitis+C+virus+replication+compartment.">Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment.</a> J. Virol. 87, 10612-10627 (2013).</li><li>Busch, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+Nucleoli.">Isolation of Nucleoli.</a> Exp Cell Res. 24, 150-163 (1963).</li><li>Lam, Y. W., Lyon, C. E., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+isolation+of+Cajal+bodies+from+HeLa+cells.">Large-scale isolation of Cajal bodies from HeLa cells.</a> Mol. Biol. Cell. 13, 2461-2473 (2002).</li><li>Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+nucleolus.">The nucleolus.</a> J Cell Sci. 118, 1335-1337 (2005).</li><li>Groitl, P., Dobner, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+adenovirus+type+5+early+region+1+and+4+virus+mutants.">Construction of adenovirus type 5 early region 1 and 4 virus mutants.</a> Methods Mol Med. 130, 29-39 (2007).</li><li>Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+which+recognize+native+and+denatured+forms+of+the+adenovirus+DNA-binding+protein.">Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein.</a> Virology. 128, 480-484 (1983).</li><li>Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+effects+on+adenovirus+late+gene+expression+of+deleting+the+E1b+55K+protein.">Selective effects on adenovirus late gene expression of deleting the E1b 55K protein.</a> J Gen Virol. 74 (Pt 4), 575-582 (1993).</li><li>Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+E1B+55-kilodalton+protein+is+required+for+both+regulation+of+mRNA+export+and+efficient+entry+into+the+late+phase+of+infection+in+normal+human+fibroblasts.">Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts.</a> J. Virol. 80, 964-974 (2006).</li><li>Castillo-Villanueva, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Mre11+Cellular+Protein+Is+Modified+by+Conjugation+of+Both+SUMO-1+and+SUMO-2/3+during+Adenovirus+Infection.">The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection.</a> ISRN Virology. 2014, 14 (2014).</li><li>Morris, S. J., Scott, G. E., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+late-phase+infection+is+controlled+by+a+novel+L4+promoter.">Adenovirus late-phase infection is controlled by a novel L4 promoter.</a> J. Virol. 84, 7096-7104 (2010).</li><li>Wright, J., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+adenovirus+5+L4+promoter+is+activated+by+cellular+stress+response+protein+p53.">The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53.</a> J. Virol. 87, 11617-11625 (2013).</li></ol>

The authors have nothing to disclose.

In order to elucidate the molecular mechanisms that govern regulation of cellular activities by viral infection understanding the composition and activities associated with RC would be instrumental. Therefore, to make a detailed analysis of RC, we established a cell-free system that takes advantage of the size and biochemical composition of these virus-induced structures, to isolate subnuclear fractions enriched with RC using a simple procedure that relies on velocity gradients with sucrose cushions. Critical steps of th...

Adenoviruses contain a double-stranded DNA genome that replicates in the infected cell nucleus. When the viral DNA enters the nucleus, it localizes adjacent to PML nuclear bodies1. Following viral early gene expression, the nuclear architecture is dramatically reorganized, inducing formation of viral microenvironments, termed viral Replication Compartments (RC)2. Since adenovirus (Ad) RC are sites where viral genome replication and expression of viral late genes take place, they provide an environment for recruitment of all the necessary viral and cellular factors that participate in these processes. Interestingly, a variety of cellular proteins responsible for the cellular antiviral response, such as the DNA damage response, the innate immune response and tumor suppression are co-opted to these viral sites2. Hence, Ad RC can be considered regulatory hubs that promote efficient viral replication while concomitantly regulating the cellular antiviral response, indicating that these structures are key to the understanding of virus-host cell interactions. Nevertheless, the molecular mechanisms of RC formation, their composition and associated activities are poorly understood.
Adenoviral RC, as well as RC from other DNA viruses that replicate in the nucleus are not associated to membranes, in contrast to cytoplasmic RC3. Moreover, these virus-induced structures are likely to be composed entirely of proteins and nucleic acids. RC formed in cells infected with RNA viruses (usually termed viral factories) have been isolated, taking advantage of their cytoplasmic localization and membrane-bound status, which has facilitated their detailed morphological, functional and biochemical characterization4.
To our knowledge, nuclear viral RC have not been isolated, perhaps due to the complexity of the nuclear architecture and absence of intranuclear membranes that would facilitate their isolation. Their study has relied instead on immunofluorescence microscopy, FISH and transmission electron microscopy. However, despite complications inherent to isolating subnuclear structures, other nuclear domains such as nucleoli and Cajal Bodies have been isolated before 5,6. Since nucleoli and RC are both composed of proteins and nucleic acids, and have a diameter between 0.5 - 5 &#181;m, we hypothesized that RC should also be amenable to isolation. Therefore, in order to more precisely characterize the molecular composition and functions associated to RC, we established a novel method to isolate subnuclear fractions enriched with RC. To this end, we prepared sub-nuclear fractions using velocity gradients and sucrose cushions similar to procedures used to isolate nucleoli7 or other nuclear domains6 and established a cell-free system that allows the study of the molecular composition and associated activities of RC. This technique should therefore advance the understanding of virus-host cell interactions and represents a powerful tool that should also facilitate the detailed analysis of RC from other viruses that replicate in the nucleus and induce formation of replication compartments of similar dimensions to those formed in adenovirus-infected-cells, such as, herpesviruses, papillomaviruses or polyomaviruses.

<table border="0">
	<tbody>
		<tr>
			<td>DMEM</td>
			<td>Gibco</td>
			<td>12100-046</td>
			<td>Warm in 37 &#186;C water bath before use</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Gibco</td>
			<td>12484-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose, Ultra Pure</td>
			<td>Research Organics</td>
			<td>0928S</td>
			<td>Prepare a 2.55 M stock solution and store at 4 &#186;C</td>
		</tr>
		<tr>
			<td>Dounce homogenizer</td>
			<td>Kontess Glass Company</td>
			<td>884900-0000</td>
			<td></td>
		</tr>
		<tr>
			<td>Branson 1800 Ultrasonic Bath</td>
			<td>Branson</td>
			<td>Z769533&#160;SIGMA</td>
			<td>Turn on 15 min before use.</td>
		</tr>
		<tr>
			<td>Peroxidase AffiniPure F(ab&#39;)&#8322; Fragment Goat Anti-Mouse IgG (H+L)</td>
			<td>Jackson ImmunoResearch</td>
			<td>115-036-003</td>
			<td>Use at a 1:10,000 dilution in PBS/0.03% non-fat milk</td>
		</tr>
		<tr>
			<td>Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate</td>
			<td>Life Technologies</td>
			<td>A-21121</td>
			<td>Use at a 1:2,000 dilution in PBS</td>
		</tr>
		<tr>
			<td>Silane-Prep Slides</td>
			<td>Sigma</td>
			<td>S4651-72EA</td>
			<td>Open in a laminar flow cabinet</td>
		</tr>
		<tr>
			<td>SuperSignal West Pico Chemiluminescent Substrate</td>
			<td>Pierce ThermoScientific</td>
			<td>34080</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of viral replication compartment-enriched sub-nuclear fractions from adenovirus-infected normal human cells

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments through the recruitment of viral and cellular proteins to sites occupied by the viral genome. These sites, called replication compartments (RC), can be considered viral-induced nuclear domains where the viral genome is localized and viral and cellular proteins that participate in replication, transcription and post-transcriptional processing are recruited. Moreover, cellular proteins involved in the antiviral response, such as tumor suppressor proteins, DNA damage response (DDR) components and innate immune response factors are also co-opted to RC. Although RC seem to play a crucial role to promote an efficient and productive replication cycle, a detailed analysis of their composition and associated activities has not been made. To facilitate the study of adenoviral RC and potentially those from other DNA viruses that replicate in the cell nucleus, we adapted a simple procedure based on velocity gradients to isolate Ad RC and established a cell-free system amenable to conduct morphological, functional and compositional studies of these virus-induced subnuclear structures, as well as to study their impact on host-cell interactions.

Since viral replication compartments (RC) are subnuclear viral-induced structures composed of proteins and nucleic acids, similar to other nuclear domains, they proved to be amenable to isolation by velocity gradients based on biochemical features. Critical steps in the fractionation protocol are illustrated in Figure 1. At each step the samples need to be monitored by bright field microscopy to ensure integrity of the different sub-cellular fractions. For example, when swelling the cells, incubation tim...

Watch this Scientific Journal Video about Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells at JoVE.com

Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC.

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments ...

isolation-viral-replication-compartment-enriched-sub-nuclear

Research

JoVE Journal

Immunology and Infection

8.7K Views.  Universidad Autónoma del Estado de Morelos. We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC. 

Video: Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

Preparation of Viral DNA from Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. Several downstream applications require large quantities of pure viral DNA, which is provided by this protocol. These applications include viral genome sequencing, where the removal of host DNA is crucial to optimize data output for viral sequences, and the production of new viral recombinant strains, where co-transfection of purified plasmid and linear viral DNA facilitates recombination.1,2,3 
This procedure utilizes a combination of extractions and density-based centrifugation to isolate purified linear herpesvirus nucleocapsid DNA from infected cells.4,5 The initial purification steps aim to isolate purified viral capsids, which contain and protect the viral DNA during the extractions and centrifugation steps that remove cellular proteins and DNA. Lysis of nucleocapsids then releases viral DNA, and two final phenol-chloroform steps remove remaining proteins. The final DNA captured from solution is highly concentrated and pure, with an average OD260/280 of 1.90. Depending on the quantity of infected cells used, yields of viral DNA range from 150-800 &mu;g or more. The purity of this DNA makes it stable during long-term storage at 4C. This DNA is thus ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections. 
Prior to beginning the protocol, it is important to know the average number of cells per dish (e.g. an average of 8 x 106 PK-15 cells in a confluent 15 cm dish), and the titer of the viral stock to be used (e.g. 1 x 108 plaque-forming units per ml). These are necessary to calculate the appropriate multiplicity of infection (MOI) for the protocol.6 For instance, to infect one 15 cm dish of PK-15 cells with the above viral stock, at an MOI of 5, you would use 400 &mu;l of viral stock and dilute it with 3.6 ml of medium (total inoculation volume of 4 ml for one 15 cm plate).
Multiple viral DNA preparations can be prepared at the same time. The number of simultaneous preparations is limited only by the number of tubes held by the ultracentrifuge rotor (one per virus; see step 3.9 below). Here we describe the procedure as though being done for one virus.

We describe the process of isolating high purity herpesvirus nucleocapsid DNA from infected cells. The final DNA captured from solution is of high concentration and purity, making it ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections to produce new viral recombinants.

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Isolation of Myeloid Dendritic Cells and Epithelial Cells from Human Thymus

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen presenting cell (APC) types found in a normal thymus and it is well established that they play distinct roles during thymic selection. These cells are localized in distinct microenvironments in the thymus and each APC type makes up only a minor population of cells. To further understand the biology of these cell types, characterization of these cell populations is highly desirable but due to their low frequency, isolation of any of these cell types requires an efficient and reproducible procedure. This protocol details a method to obtain cells suitable for characterization of diverse cellular properties. Thymic tissue is mechanically disrupted and after different steps of enzymatic digestion, the resulting cell suspension is enriched using a Percoll density centrifugation step. For isolation of myeloid DC (CD11c+), cells from the low-density fraction (LDF) are immunoselected by magnetic cell sorting. Enrichment of TEC populations (mTEC, cTEC) is achieved by depletion of hematopoietic (CD45hi) cells from the low-density Percoll cell fraction allowing their subsequent isolation via fluorescence activated cell sorting (FACS) using specific cell markers. The isolated cells can be used for different downstream applications.

This protocol details a method to isolate antigen presenting cells from human thymus via different steps of enzymatic digestion of the tissue followed by density centrifugation of the single cell suspension and finally magnetic and/or FACS sorting of the cell populations of interest.

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen ...

Averaging of Viral Envelope Glycoprotein Spikes from Electron Cryotomography Reconstructions using Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these glycoprotein &#8216;spikes&#8217; is often technically challenging but important for understanding viral pathogenesis and in drug design. Here, a protocol is presented for viral spike structure determination through computational averaging of electron cryo-tomography data. Electron cryo-tomography is a technique in electron microscopy used to derive three-dimensional tomographic volume reconstructions, or tomograms, of pleomorphic biological specimens such as membrane viruses in a near-native, frozen-hydrated state. These tomograms reveal structures of interest in three dimensions, albeit at low resolution. Computational averaging of sub-volumes, or sub-tomograms, is necessary to obtain higher resolution detail of repeating structural motifs, such as viral glycoprotein spikes. A detailed computational approach for aligning and averaging sub-tomograms using the Jsubtomo software package is outlined. This approach enables visualization of the structure of viral glycoprotein spikes to a resolution in the range of 20-40 &#197; and study of the study of higher order spike-to-spike interactions on the virion membrane. Typical results are presented for Bunyamwera virus, an enveloped virus from the family Bunyaviridae. This family is a structurally diverse group of pathogens posing a threat to human and animal health.

An approach is presented for determining structures of viral membrane glycoprotein complexes using a combination of electron cryo-tomography and sub-tomogram averaging with the computational package Jsubtomo.

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these ...

Isolation of Leukocytes from the Human Maternal-fetal Interface

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua parietalis). This interface is the anatomical site of contact between maternal and fetal tissues; therefore, it is an immunological site of action during pregnancy. Infiltrating leukocytes at the maternal-fetal interface play a central role in implantation, pregnancy maintenance, and timing of delivery. Therefore, phenotypic and functional characterizations of these leukocytes will provide insight into the mechanisms that lead to&#160;pregnancy disorders. Several protocols have been described in order to isolate infiltrating leukocytes from the decidua basalis and decidua parietalis; however, the lack of consistency in the reagents, enzymes, and times of incubation makes it difficult to compare these results. Described herein is&#160;a novel approach that combines the use of gentle mechanical and enzymatic dissociation techniques to preserve the viability and integrity of extracellular and intracellular markers in leukocytes isolated from the human tissues at the maternal-fetal interface. Aside from immunophenotyping, cell culture, and cell sorting, the future applications of this protocol are numerous and varied. Following this protocol, the isolated leukocytes can be used to determine DNA methylation, expression of target genes, in vitro leukocyte functionality (i.e., phagocytosis, cytotoxicity, T-cell proliferation, and plasticity, etc.), and the production of reactive oxygen species at the maternal-fetal interface. Additionally, using the described protocol, this laboratory has been able to describe new and rare leukocytes at the maternal-fetal interface.

Described herein is a protocol to isolate and further study the infiltrating leukocytes of the decidua basalis and decidua parietalis - the human maternal-fetal interface. This protocol maintains the integrity of cell surface markers and yields enough viable cells for downstream applications as proven by flow cytometry analysis.

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua ...

Isolation of Sertoli Cells and Peritubular Cells from Rat Testes

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of puberty - more than ten years after the establishment of systemic immune tolerance. Spermatogenic cells express a number of proteins that may be seen as non-self by the immune system. The testis must then be able to establish tolerance to these neo-antigens on the one hand but still be able to protect itself from infections and tumor development on the other hand. Therefore the testis is one of a few immune privileged sites in the body that tolerate foreign antigens without evoking a detrimental inflammatory immune response. Sertoli cells play a key role for the maintenance of this immune privileged environment of the testis and also prolong survival of cotransplanted cells in a foreign environment. Therefore primary Sertoli cells are an important tool for studying the immune privilege of the testis that cannot be easily replaced by established cell lines or other cellular models. Here we present a detailed and comprehensive protocol for the isolation of Sertoli cells - and peritubular cells if desired - from rat testes within a single day.

Primary Sertoli cells are required for studying testis-immune privilege, signal transduction during inflammation or infection, and utilization of their immunoprotective properties. Here we describe an enzyme-based protocol for the isolation of highly purified primary Sertoli cells and peritubular cells from rat testes.

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the person-to-person route or indirectly through environmental surfaces or food, contaminated fomites and inanimate surfaces are important vehicles for the spread of the virus during norovirus outbreaks.
We developed and evaluated a protocol using macrofoam swabs for the detection and typing of human noroviruses from hard surfaces. Compared with fiber-tipped swabs or antistatic wipes, macrofoam swabs allow virus recovery (range 1.2-33.6%) from toilet seat surfaces of up to 700 cm2. The protocol includes steps for the extraction of the virus from the swabs and further concentration of the viral RNA using spin columns. In total, 127 (58.5%) of 217 swab samples that had been collected from surfaces in cruise ships and long-term care facilities where norovirus gastroenteritis had been reported tested positive for GII norovirus by RT-qPCR. Of these 29 (22.8%) could be successfully genotyped. In conclusion, detection of norovirus on environmental surfaces using the protocol we developed may assist in determining the level of environmental contamination during outbreaks as well as detection of virus when clinical samples are not available; it may also facilitate monitoring of effectiveness of remediation strategies.

A macrofoam based sampling methodology was developed and evaluated for the detection and quantification of norovirus on environmental hard surfaces.

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

Isolation of Dendritic Cells from the Human Female Reproductive Tract for Phenotypical and Functional Studies

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low numbers of DCs present per tissue. Yet, as the phenotype and function of DCs is modified by the tissue environment, it is necessary to analyze tissue resident DC populations, since blood derived DCs incompletely reflect the complexities of DCs in tissues. Here we present a protocol to isolate DCs from the human female reproductive tract (FRT) using hysterectomy specimens that allows both phenotypical and functional analyses. The protocol consists of tissue digestion to generate a single cell mixed cell suspension, followed by positive magnetic bead selection. Our tissue digestion protocol does not cleave surface markers, which allows phenotypical and functional analysis of DCs in the steady state, without overnight incubation or cell activation. This protocol can be adapted for the isolation of other immune cell types or isolation of DCs from other tissues.

We describe here a method to isolate and purify dendritic cells from different anatomical compartments in the human female reproductive tract for the evaluation of their phenotypical and functional characteristics. This method can be adapted to isolate other immune cells or dendritic cells from other mucosal tissues.

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low ...

Isolation, Expansion, and Adipogenic Induction of CD34+CD31+ Endothelial Cells from Human Omental and Subcutaneous Adipose Tissue

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor response to insulin, local hypoxia, and inflammation. By stimulating the differentiation of functional white adipocytes from progenitors, radical hypertrophy of the adipocyte population can be prevented and, consequently, the metabolic health of adipose tissue can be improved along with a reduction of inflammation. Also, by stimulating a differentiation of beige/brown adipocytes, the total body energy expenditure can be increased, resulting in weight loss. This approach could prevent the development of obesity co-morbidities such as type 2 diabetes and cardiovascular disease.
This paper describes the isolation, expansion, and differentiation of white and beige adipocytes from a subset of human adipose tissue endothelial cells that co-express the CD31 and CD34 markers. The method is relatively cheap and is not labor-intensive. It requires access to human adipose tissue and the subcutaneous depot is suitable for sampling. For this protocol, fresh adipose tissue samples from morbidly obese subjects [body mass index (BMI) &#62;35] are collected during bariatric surgery procedures. Using a sequential immunoseparation from the stromal vascular fraction, enough cells are produced from as little as 2&#8211;3 g of fat. These cells can be expanded in culture over 10&#8211;14 days, can be cryopreserved, and retain their adipogenic properties with passaging up to passage 5&#8211;6. The cells are treated for 14 days with an adipogenic cocktail using a combination of human insulin and the PPAR&#947; agonist-rosiglitazone.
This methodology can be used for obtaining proof of concept experiments on molecular mechanisms that drive adipogenic responses in adipose endothelial cells, or for screening new drugs that can enhance the adipogenic response directed either towards white or beige/brown adipocyte differentiation. Using small subcutaneous biopsies, this methodology can be used to screen out non-responder subjects for clinical trials aimed to stimulate beige/brown and white adipocytes for the treatment of obesity and co-morbidities.

The differentiation of white and beige adipocytes from adipose tissue vascular progenitors bears potential for metabolic improvement in obesity. We describe protocols for a CD34+CD31+ endothelial cell isolation from human fat and for a subsequent in vitro expansion and differentiation into white and beige adipocytes. Several downstream applications are discussed.

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor ...