The development of the DNA stretching assay was aided by Paul Blainey, Jong-Bong Lee, and Samir Hamdan. This work is supported by the National Institutes of Health grants to Charles Richardson (GM54397), and Antoine van Oijen (GM077248).

1. DNA Replication Template
DNA for the reaction is a linearized &lambda; DNA modified by annealing of oligonucleotides to form a replication fork. &nbsp;Additionally, biotin is attached to the end of one strand of the &lambda; DNA, and a digoxigenin moiety is attached to the other end of the same strand1.
Materials: Bacteriophage &lambda; DNA, Oligonucleotides: biotinylated fork arm (A: 5'-biotin-AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC-3'), &lambda;-complementary fork arm (B: 5'-GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA-3'), fork primer (C: 5'-TGCCATATCTGAAATCCTCCCTGC-3'), &lambda;-complementary digoxigenin end (D: 5'-AGGTCG CCGCCCAAAAAAAAAAAA-digoxigenin-3'), T4 DNA Ligase, T4 polynucleotide Kinase, Heat block.
<ol>
 <li>Phosphorylate the 5' ends of oligonucleotides B and D using T4 Polynucleotide Kinase.</li>
 <li>Anneal oligonucleotides A, B, and C to the &lambda; DNA in one step by adding a 10-fold excess of oligonucleotides A and B, and a 100-fold excess of oligonucleotide C in T4 DNA ligase buffer.</li>
 <li>Heat the mixture to 65 &deg;C in the heat block. Once heated, turn the heat block off and allow slow cooling to properly anneal oligonucleotides.</li>
 <li>Add T4 DNA ligase to the mixture and incubate at room temperature for 2 hours.&nbsp; T4 DNA Ligase will catalyze the correct joining of oligonucleotides A and B, and &lambda; DNA.</li>
 <li>Finally, anneal the oligonucleotide D to the DNA replication template by adding 100-fold excess of oligonucleotide D with respect to l DNA in T4 DNA ligase buffer.</li>
 <li>Incubate the mixture at 45 &deg;C for 30 min in the heat block, and cool to room temperature slowly by turning heat block off.</li>
 <li>The final DNA replication template is now ready for use.&nbsp; We store the template at a concentration of 1.4 nM at 4 &deg;C for several weeks.</li>
</ol>
2. Beads
Beads are functionalized with a Fab fragment with specificity for digoxigenin. They can be then attached to the DNA replication template2.
Materials: Tosyl activated beads, &alpha;-digoxigenin Fab fragment, Buffer A: 0.1 M H3BO3 pH 9.5, Buffer B: 0.1 M PBS pH 7.4, 0.1% w/v BSA, Buffer C: 0.2 M Tris-HCl pH 8.5 (25 &deg;C), 0.1% w/v BSA, Magnetic Separator, Rotator.
<ol>
	<li>Resuspend the stock solution of beads and transfer a small aliquot into the eppendorf tube. Place the tube into a slot of the magnetic separator and incubate until solution clears, then remove supernatant by pipetting.</li>
	<li>Add buffer A, which will activate tosyl groups for antibody coupling. Mix gently by pipetting and remove buffer with the magnetic separator.</li>
	<li>Add Fab fragment and resuspend beads again in buffer A, mix thoroughly, and incubate 16-24 hours at 37 &deg;C using rotator. After incubation, separate beads using the magnetic separator and remove buffer.</li>
	<li>Wash beads by adding buffer B and incubate at 4 &deg;C for 5 min. Remove the buffer using magnetic separator.&nbsp; Repeat washing twice.</li>
	<li>Add buffer C and incubate at 37 &deg;C for 4 hours to block free tosyl groups. Separate beads using magnetic separator and remove buffer.</li>
	<li>Wash twice in buffer B and aliquot for use. Beads can be stored at 4 &deg;C for 1 year or longer without substantial loss of quality (our stock solution contains 1- 2x109 beads/ml).</li>
</ol>
3. Functionalized Coverslips
To allow attachment of the DNA to the glass coverslip, the glass is first functionalized with an aminosilane, which is then coupled to biotinylated PEG molecules. This coating helps to reduce the nonspecific interactions of DNA and replication proteins with the surface3,4.
Materials: Glass coverslips, Staining jars, 3-aminopropyltriethoxysilane, Methoxy-PEG5k-NHS ester, Biotin-PEG5k-NHSester, Acetone, 1M KOH, Ethanol, Oven, Bath sonicator
<ol>
	<li>Thoroughly clean the glass coverslips by placing them in staining jars and filling the jars with ethanol. Sonicate for 30 minutes, rinse out the jars and fill with 1 M KOH. Repeat both washes.</li>
	<li>For the first functionalization reaction, all traces of water need to be removed. Fill the jars with acetone and sonicate for 10 min. Empty and fill again with acetone.</li>
	<li>Prepare a 2 % v/v solution of the silane reagent in acetone. Add to the staining jars and agitate for 2 minutes. This reaction couples the alkoxy group of the aminosilane to the glass, leaving a reactive amine for the next coupling step.&nbsp; Quench the reaction with a large excess of water.</li>
	<li>Dry the coverslips by baking them at 110 &deg;C in the oven for 30 minutes.</li>
	<li>Prepare a 50:1 methoxy:biotin PEG mixture in 100 mM NaHCO3 pH 8.2. Aim for around 0.2 % w/v biotinylated PEG.</li>
	<li>Pipette 100 &mu;L of the PEG mixture onto a dry silanized coverslip and place another coverslip on top. Including a glass coverslip spacer will allow separation of the coverslips.</li>
	<li>Incubate the coverslips in the PEG solution for 3 hours, then separate each pair of coverslips and wash extensively with water. Be careful to keep the coverslips functionalized side up as only once side will be coated with PEG.</li>
	<li>Dry the coverslips with air and store under vacuum in desiccator. The surfaces remain stable for at least a month, so dozens of coverslips can be made in a batch and used as needed.</li>
</ol>
4. Flow Chamber Preparation
The experiment is performed using a simple flow chamber constructed with a functionalized coverslip, double-sided tape, a quartz slide and tubing. One flow chamber is prepared for each single-molecule experiment2,4.
Materials: Double-sided tape, razor blade, quartz slide with holes for tubing, quick-dry epoxy, Functionalized coverslip, streptavidin solution (25 &mu;L of 1 mg/mL in PBS), tubing, blocking buffer (5X: 20 mM Tris pH 7.5, 2 mM EDTA, 50 mM NaCl, 0.2 mg/mL BSA, 0.005% Tween-20), working buffer (1X: 20 mM Tris-HCl pH 7.5, 2 mM EDTA, 50 mM NaCl).
<ol>
	<li>Begin by mixing and placing 5 mL of blocking buffer and 20 ml of working buffer in a desiccator to remove any air bubbles for later steps.</li>
	<li>Take a PEG-functionalized coverslip and spread 125 of PBS-diluted streptavidin solution over the surface. Leave this to incubate for 20 minutes at room temperature while preparing other parts of the chamber, allowing streptavidin to bind surface biotins.</li>
	<li>Cut a piece of double-sided tape to match the size of the quartz slide. Mark the position of the tubing holes on the tape so that an outline of the flow chamber can be drawn on the tape.</li>
	<li>Make a 3 mm-wide center channel and rectangles containing both holes. We use flow chambers with two inlet and two outlet Y-shaped channels.</li>
	<li>Cut along the drawn outline, making straight, clean cuts to make sure no adhesive protrudes into the channel.</li>
	<li>Clean the quartz thoroughly using acetone or ethanol to remove adhesive from the previous flow cell construction.</li>
	<li>Find the best alignment of the channel outline, remove one side of the adhesive backing and carefully place the tape onto the quartz slide. Be careful to align the tape properly, as the inlet and outlet holes need to remain unblocked.</li>
	<li>Cut lengths of tubing for the inlet and outlet of the flow cell. It helps to cut the end of the tube at about a 30&deg; angle so that the tube will not press flat against the chamber bottom. Place the tubes on some sort of support (e.g. tube racks) to suspend them for easy attachment to the flow cell in the next steps.</li>
	<li>Rinse the streptavidin-coated coverslip thoroughly with water and dry using compressed air. Remember that only one side is functionalized. Remove the other side of the tape backing and place the quartz slide onto the coverslip.</li>
	<li>Lightly press on the coverslip to push out any air trapped in the adhesive. This will help avoid any air bubbles getting into the flow channel.</li>
	<li>Seal the sides of the chamber with epoxy. Insert the cut tubing into the holes of the quartz and seal in place with epoxy. This needs to dry for a few minutes.</li>
	<li>Once dry, begin blocking the surface by pulling some of the degassed blocking buffer through one of tubes. A 21-gauge needle fits perfectly inside the 0.76 mm tubing. Flush out a few times to remove air bubbles, and allow the chamber to incubate for at least half an hour.</li>
</ol>
5. Single-molecule Replication Experiment
Once the DNA template and functionalized beads have been prepared, and the flow chamber is ready, a single-molecule experiment can be performed.
Materials: Prepared flow chamber, Blocking buffer (5X : 20 mM Tris-HCl pH 7.5, 2 mM EDTA, 50 mM NaCl, 1 mg/mL BSA, 0.025% Tween-20), Working buffer (1X: 20 mM Tris-HCl pH 7.5, 2 mM EDTA, 50 mM NaCl), T7 replication buffers with or without 10mM MgCl2 (1X: 40 mM Tris-HCl pH 7.5, 50 mM K-glutamate, 2 mM EDTA, 100 &mu;g/ml BSA, 10 mM DTT, 600 &mu;M dNTPs), replication proteins, inverted optical microscope with 10X objective, CCD camera, permanent rare-earth magnet, syringe pump, airspring, fiber illuminator, computer with image acquisition software.
<ol>
	<li>After the flow cell has been blocked, it is ready to begin the experiment.</li>
	<li>Take the flow cell and place it on the microscope stage. Hold the chamber in place with stage clips and be sure that the flow channel is positioned in alignment with CCD camera.</li>
	<li>Connect the flow cell outlet tubes to the airspring using a larger diameter connector tubing or a needle. The airspring is used to stabilize any flow irregularities. A 50 ml plastic tube is filled with 45ml of water. The lid of the tube is sealed with epoxy. Three holes are pierced in the lid, and three pieces of tubing are inserted into the tube. Using epoxy, the tubes are then sealed to the lid, preventing any air from entering or escaping. The airspring is connected to the syringe pump, and to the outlet tubes of the flow cell.</li>
	<li>Place the inlet tubes of the flow cell in blocking buffer and pull back on the syringe to remove any air in the tube. A gentle flick of the outlet tube will help clear any air bubbles trapped in the flow cell.</li>
	<li>Once all air bubbles have been removed, block one of the inlet tubes with a needle, and one of the outlet tubes by bending it by 1800 and securing the tube with adhesive tape.</li>
	<li>Dilute the stock DNA template to 10 pM in 1 ml of degassed blocking buffer. Flow into the chamber at moderate flow rate to allow good surface coverage of DNA (0.01-0.05 ml/min for 20 minutes works well). This can be varied based on how many DNA molecules are on the surface for each batch of coverslips or how many are desired for the experiment.</li>
	<li>Dilute the stock bead solution to 2-4x106 beads/ml in 1 ml of degassed blocking buffer. Flow into the chamber at 0.01-0.05 ml/min for 15 minutes.</li>
	<li>Once beads are added, turn the flow off and allow chamber to reach equilibrium. Then close both outlet tubes. Any changes to the tubes without the chamber closed will cause pressure fluctuations that will exert a strong force on the beads and shear the tethered DNA molecules.</li>
	<li>Block the inlet tube that was used for loading beads with a needle, and begin washing the flow cell using the second inlet with degassed 1X solution of blocking buffer in working buffer. Wash extensively at the rate of 0.01-0.05 ml/min. Agitate manually the stage by tapping to remove any beads nonspecifically stuck to the surface (<a href="https://www.jove.com/files/ftp_upload/1689/Tapping.avi">Tapping</a>).</li>
	<li>Once free beads are sufficiently removed, turn the flow off and allow chamber to reach equilibrium. Close the open outlet tube and switch the inlet reservoir to protein solution, slowly opening the outlet to avoid rapid pressure changes</li>
	<li>You can check if beads are tethered to DNA by changing direction of the flow (<a href="https://www.jove.com/files/ftp_upload/1689/DNA.avi">DNA</a>).</li>
	<li>Now, the enzymatic reaction can be performed. For leading-strand synthesis experiments make 20nM solution of gp4 helicase and 20nM solution of gp5 polymerase (purified as a complex with its processivity factor thioredoxin) in degassed T7 replication buffer that does not contain MgCl2.</li>
	<li>Flow the protein solution into the chamber at moderate flow rate to allow efficient binding to DNA.&nbsp; We use 0.037 ml/min for 8 minutes, and then 0.012 ml/min for 7 minutes.</li>
	<li>Wash the chamber with degassed T7 replication buffer without MgCl2 to remove free proteins. The rate of 0.037 ml/min for 3-10 minutes works fine.</li>
	<li>After washing, flow T7 replication buffer with MgCl2 and begin data acquisition. Use a flow rate of 0.012 ml/min corresponding to 3 pN drag force on the DNA tethers under conditions described in this protocol.</li>
	<li>Place a rare-earth permanent magnet above the flow cell before imaging to prevent nonspecific interactions between beads and surface.</li>
	<li>View field with a 10X objective and CCD camera. Focus using a tethered bead.</li>
	<li>Position a fiber illuminator at an incidence angle between 10 degrees and parallel to the microscope stage near the microscope. Dark-field illumination is used to increase the contrast in the bead imaging.</li>
	<li>Acquire data for 20 30 min at a slow frame rate (typically 2-4 Hz).</li>
</ol>
6. Representative Results
In a successful experiment you should be able to observe more than 100 beads simultaneously (<a href="https://www.jove.com/files/ftp_upload/1689/Leading_strand_synthesis.avi">Leading strand synthesis</a>). The experiment should yield numerous traces displaying leading strand DNA synthesis.
Data Analysis:
In order to measure rates and processivities of DNA unwinding and polymerization, the precise positions of beads must be determined. You can achieve it by fitting these positions with 2-dimensional Gaussian functions. Trajectories can then be extracted by tracking bead position at each frame using tracking software (e.g. DiaTrack). Now you are ready to visualize trajectories by plotting bead position as a function of time using any graphic software (e.g. Origin). To obtain rate data, fit the plots with a linear regression and calculate the slope. For processivity, determine the total length of the DNA from start to end of a shortening event (Figure 3). Both of these numbers will need to be converted to basepairs. To convert bead movement to basepairs, first you need to measure the length of a stretched &lambda; DNA molecule at the reaction flow rate. Since the length of the &lambda; DNA is known (48,502 bp) you can calibrate the number of base pairs/pixel at experimental force. For increased accuracy, subtract from the traces of interest a baseline trace of a bead tether that is not enzymatically altered. Combine all single measurements and plot rate and processivity distributions. Fit the data using Gaussian and single-exponential functions, respectively (Figure 3).
<img src="/files/ftp_upload/1689/1689fig1.jpg" alt="Figure 1" /> Figure 1. Single-molecule experimental setup. (a) Duplex &lambda; DNA (48.5 kb) is attached to the surface of the flow cell via the 5' end of one strand using a biotin-streptavidin interaction, and the 3' end of the same strand is attached to a bead using a digoxigenin anti-digoxigenin interaction. A primed replication fork is formed at the end opposite the bead to allow loading of the polymerase. (b) Bead-DNA assemblies are stretched using laminar flow of buffer and imaged using wide-field optical microscopy. By tracking the positions of the beads over time, while maintaining a constant stretching force, the lengths of the DNA constructs can be monitored. (c) Extension profile of ssDNA (filled circle) and dsDNA (open circle) under low forces. Dashed line shows crystallographic length of fully ds-&lambda; DNA, 16.3 &mu;m. The large difference in length between ssDNA and dsDNA at forces around 3 pN allows a direct observation of conversions between ss- and dsDNA by monitoring changes in the DNA length. The simultaneous visualization of large numbers of DNA-coupled beads allows for the study of many individual replisomes in one experiment.
<img src="/files/ftp_upload/1689/1689fig2.jpg" alt="Figure 2" /> Figure 2. Bacteriophage T7 replication proteins: DNA polymerase (complex of gp5 and thioredoxin) and DNA helicase (gp4) synthesize DNA leading strand in the presence of deoxyribonucleotides and magnesium. This process is accompanied by shortening of DNA lagging strand due to coiling. Conversion of dsDNA into ssDNA changes position of the bead. Measuring position of the bead allows precise determination of the rate and processivity of DNA replication.
<img src="/files/ftp_upload/1689/1689fig3.jpg" alt="Figure 3" /> Figure 3. Example of typical data from a single-molecule leading-strand synthesis experiment. Processivity of DNA replication is equal to a total length of the DNA from start to end of a shortening event. The rate of DNA replication is obtained by fitting the plot with a linear regression and calculating the slope. The inset shows rate and processivity distributions that were obtained by combining data from a number of measurements. Data were fitted using Gaussian and single-exponential functions, respectively.

<ol>
	<li>Lee, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+primase+acts+as+a+molecular+brake+in+DNA+replication.">DNA primase acts as a molecular brake in DNA replication.</a> Nature. 439, 621-624 (2006).</li><li>Tanner, N. A., van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+observation+of+prokaryotic+DNA+replication.">Single-molecule observation of prokaryotic DNA replication.</a> Methods Mol Biol. 521, 397-410 (2009).</li><li>Sofia, S. J., Premnath, V. V., Merrill, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly(ethylene+oxide)+Grafted+to+Silicon+Surfaces:+Grafting+Density+and+Protein+Adsorption.">Poly(ethylene oxide) Grafted to Silicon Surfaces: Grafting Density and Protein Adsorption.</a> Macromolecules. 31, 5059-5070 (1998).</li><li>Tanner, N. A., Loparo, J. J., van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+single-molecule+DNA+replication+with+fluorescence+microscopy.">Visualizing single-molecule DNA replication with fluorescence microscopy.</a> J Vis Exp. , (2009).</li><li>Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+DNA+replication+loops+reveal+temporal+control+of+lagging-strand+synthesis.">Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis.</a> Nature. 457, 336-339 (2009).</li><li>van Oijen, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+kinetics+of+lambda+exonuclease+reveal+base+dependence+and+dynamic+disorder.">Single-molecule kinetics of lambda exonuclease reveal base dependence and dynamic disorder.</a> Science. 301, 1235-1238 (2003).</li></ol>

It is important to ensure that the drag force exerted on beads by laminar flow doesn't influence enzymatic activities of the replication proteins. For instance, a 3 pN force that corresponds to a flow rate of 0.012 ml/min does not affect replication of the DNA leading strand. It does however affect enzymatic activities that take place during coordinated DNA synthesis, and it therefore has to be reduced to 1.5 pN. The drag force can be easily controlled by changing the flow rate or a width of the flow channel5....

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">	
		
		<div>
		<table border="1">
		<thead>
		<tr>
		<th>Material Name</th>
		<th>Type</th>
		<th>Company</th>
		<th>Catalogue Number</th>
		<th>Comment</th>
		</tr>
		</thead>
		<tbody>
		
<tr>
<td>Bacteriophage &lambda; DNA</td>
<td>&nbsp;</td>
<td>New England Biolabs</td>
<td>N3011L</td>
<td>&nbsp;</td>
<tr>
<td>DNA Oligonucleotides</td>
<td>&nbsp;</td>
<td>Integrated DNA Technologies</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<tr>
<td>T4 DNA Ligase</td>
<td>&nbsp;</td>
<td>New England Biolabs</td>
<td>M0202L</td>
<td>&nbsp;</td>
<tr>
<td>T4 Polynucleotide Kinase</td>
<td>&nbsp;</td>
<td>New England Biolabs</td>
<td>M0201L</td>
<td>&nbsp;</td>
<tr>
<td>&alpha;-digoxigenin Fab</td>
<td>&nbsp;</td>
<td>Roche</td>
<td>11214667001</td>
<td>&nbsp;</td>
<tr>
<td>Tosyl Activated Beads</td>
<td>&nbsp;</td>
<td>Dynal/Invitrogen</td>
<td>142-03</td>
<td>&nbsp;</td>
<tr>
<td>Magnetic Separator</td>
<td>&nbsp;</td>
<td>Invitrogen</td>
<td>Dynal MPC</td>
<td>&nbsp;</td>
<tr>
<td>3-aminopropyl-triethoxysilane</td>
<td>&nbsp;</td>
<td>Sigma</td>
<td>A3648</td>
<td>Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces</td>
</tr>
<tr>
<td>Succinimidyl propionate PEG</td>
<td>&nbsp;</td>
<td>Nektar</td>
<td>&nbsp;</td>
<td>Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.</td>
</tr>
<tr>
<td>Biotin-PEG-NHS</td>
<td>&nbsp;</td>
<td>Nektar</td>
<td>&nbsp;</td>
<td>Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.</td>
</tr>
<tr>
<td>Double-sided tape</td>
<td>&nbsp;</td>
<td>Grace BioLabs</td>
<td>SA-S-1L</td>
<td>100 &mu;m thickness</td>
</tr>
<tr>
<td>Quartz slide</td>
<td>&nbsp;</td>
<td>Technical Glass</td>
<td>20 mm (W)x 50 mm (L)x 1mm (H)</td>
<td>Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)</td>
</tr>
<tr>
<td>Polyethylene tubing</td>
<td>&nbsp;</td>
<td>Becton Dickinson</td>
<td>427416</td>
<td>0.76 mm ID, 1.22 OD 
Other size tubing can be substituted.</td>
</tr>
<tr>
<td>Streptavidin</td>
<td>&nbsp;</td>
<td>Sigma</td>
<td>S4762</td>
<td>Make 1 mg/mL solution, 25 &mu;L aliquots in PBS pH 7.3</td>
</tr>
<tr>
<td>Deoxyribonucleotide triphosphate solution mix</td>
<td>&nbsp;</td>
<td>New England Biolabs</td>
<td>N0447</td>
<td>&nbsp;</td>
<tr>
<td>Inverted Optical Microscope with 10X Objective</td>
<td>&nbsp;</td>
<td>Olympus</td>
<td>Olympus IX-51</td>
<td>&nbsp;</td>
<tr>
<td>Permament rare-earth magnet</td>
<td>&nbsp;</td>
<td>National Imports</td>
<td>www.rare-earth-magnets.com</td>
<td>&nbsp;</td>
<tr>
<td>CCD Camera</td>
<td>&nbsp;</td>
<td>QImaging</td>
<td>Rolera-XR Fast 139</td>
<td>&nbsp;</td>
<tr>
<td>Syringe Pump</td>
<td>&nbsp;</td>
<td>Harvard Apparatus</td>
<td>11 Plus</td>
<td>Operate in refill mode to facilitate solution changes</td>
</tr>
<tr>
<td>Fiber Illuminator</td>
<td>&nbsp;</td>
<td>Thorlabs Inc.</td>
<td>OSL1</td>
<td>&nbsp;</td>		</tbody>
		</table>
		</div>

direct observation of enzymes replicating dna using a single-molecule dna stretching assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. Linearized &lambda; DNA is modified to have a biotin on the end of one strand, and a digoxigenin moiety on the other end of the same strand. The biotinylated end is attached to a functionalized glass coverslip and the digoxigeninated end to a small bead. The assembly of these DNA-bead tethers on the surface of a flow cell allows a laminar flow to be applied to exert a drag force on the bead. As a result, the DNA is stretched close to and parallel to the surface of the coverslip at a force that is determined by the flow rate (Figure 1). The length of the DNA is measured by monitoring the position of the bead. Length differences between single- and double-stranded DNA are utilized to obtain real-time information on the activity of the replication proteins at the fork. Measuring the position of the bead allows precise determination of the rates and processivities of DNA unwinding and polymerization (Figure 2).

Watch this Scientific Journal Video about Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay at JoVE.com

Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system.

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. ...

direct-observation-enzymes-replicating-dna-using-single-molecule-dna

Research

JoVE Journal

Biology

18.7K Görüntüleme.  Harvard Medical School. Biz bireysel DNA molekülleri bakteriyofaj çoğaltma sistemi proteinleri aracılığı ile gerçek zamanlı çoğaltma gözlemlemek için bir yöntem açıklanmaktadır.

Video: Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides (Figure 1). The growing product double-strand DNA (dsDNA) is extended with laminar flow and visualized by using an intercalating dye. Measuring the position of the growing DNA end in real time allows precise determination of replication rate (Figure 2). Furthermore, the length of completed DNA products reports on the processivity of replication. This experiment can be performed very easily and rapidly and requires only a fluorescence microscope with a reasonably sensitive camera.


This protocol demonstrates a simple single-molecule fluorescence microscopy technique for visualizing DNA replication by individual replisomes in real time.

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA ...

DNA Stable-Isotope Probing (DNA-SIP)

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and nutrients into cellular biomass. As such, this cultivation-independent technique has been an important methodology for assigning metabolic function to the diverse communities inhabiting a wide range of terrestrial and aquatic environments. Following the incubation of an environmental sample with stable-isotope labelled compounds, extracted nucleic acid is subjected to density gradient ultracentrifugation and subsequent gradient fractionation to separate nucleic acids of differing densities. Purification of DNA from cesium chloride retrieves labelled and unlabelled DNA for subsequent molecular characterization (e.g. fingerprinting, microarrays, clone libraries, metagenomics). This JoVE video protocol provides visual step-by-step explanations of the protocol for density gradient ultracentrifugation, gradient fractionation and recovery of labelled DNA. The protocol also includes sample SIP data and highlights important tips and cautions that must be considered to ensure a successful DNA-SIP analysis.

DNA Stable-Isotope Probing DNA-SIP

DNA stable-isotope probing is a cultivation-independent method to identify and characterize active communities of microorganisms that are capable of utilizing specific substrates. Assimilation of substrate enriched in heavy isotope leads to incorporation of labelled atoms into microbial biomass. Density gradient ultracentrifugation retrieves labelled DNA for downstream molecular analyses.

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and ...

Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be produced to contain any desired DNA or RNA sequence and can be prepared to include a wide variety of base and sugar modifications. Moreover, oligos can be designed to mimic specific nucleic acid alterations and thus, can serve as important tools to investigate effects of DNA damage and mechanisms of repair. We found that Thermo Scientific Dharmacon RNA-containing oligos with a length between 50 and 80 nucleotides can be particularly suitable to study, in vivo, functions and consequences of chromosomal RNA/DNA hybrids and of ribonucleotides embedded into DNA. RNA/DNA hybrids can readily form during DNA replication, repair and transcription, however, very little is known about the stability of RNA/DNA hybrids in cells and to which extent these hybrids can affect the genetic integrity of cells. RNA-containing oligos, therefore, represent a perfect vector to introduce ribonucleotides into chromosomal DNA and generate RNA/DNA hybrids of chosen length and base composition. Here we present the protocol for the incorporation of ribonucleotides into the genome of the eukaryotic model system yeast /Saccharomyces cerevisiae/. Yet, our lab has utilized Thermo Scientific Dharmacon RNA-containing oligos to generate RNA/DNA hybrids at the chromosomal level in different cell systems, from bacteria to human cells.

This work shows how to form an RNA/DNA hybrid at the chromosomal level and reveal transfer of genetic information from RNA to genomic DNA in yeast cells.

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be ...

Visualization of DNA Replication in the Vertebrate Model System DT40 using the DNA Fiber Technique

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not only ensure faithful genome duplication in the face of endogenous and exogenous DNA damage but also prevent genomic instability, a recognized causative factor in tumor development.
Here, we describe a simple and cost-effective fluorescence microscopy-based method to visualize DNA replication in the avian B-cell line DT40. This cell line provides a powerful tool to investigate protein function in vivo by reverse genetics in vertebrate cells1. DNA fiber fluorography in DT40 cells lacking a specific gene allows one to elucidate the function of this gene product in DNA replication and genome stability. Traditional methods to analyze replication fork dynamics in vertebrate cells rely on measuring the overall rate of DNA synthesis in a population of pulse-labeled cells. This is a quantitative approach and does not allow for qualitative analysis of parameters that influence DNA synthesis. In contrast, the rate of movement of active forks can be followed directly when using the DNA fiber technique2-4. In this approach, nascent DNA is labeled in vivo by incorporation of halogenated nucleotides (Fig 1A). Subsequently, individual fibers are stretched onto a microscope slide, and the labeled DNA replication tracts are stained with specific antibodies and visualized by fluorescence microscopy (Fig 1B). Initiation of replication as well as fork directionality is determined by the consecutive use of two differently modified analogues. Furthermore, the dual-labeling approach allows for quantitative analysis of parameters that influence DNA synthesis during the S-phase, i.e. replication structures such as ongoing and stalled forks, replication origin density as well as fork terminations. Finally, the experimental procedure can be accomplished within a day, and requires only general laboratory equipment and a fluorescence microscope.

DT40, a model vertebrate genetic system, provides a powerful tool to analyze protein function. Here we describe a simple method that allows qualitative analysis of parameters that influence DNA synthesis during the S-phase in DT40 cells at the single molecule level.

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not ...

Preparation of DNA-crosslinked Polyacrylamide Hydrogels

Mechanobiology is an emerging scientific area that addresses the critical role of physical cues in directing cell morphology and function. For example, the effect of tissue elasticity on cell function is a major area of mechanobiology research because tissue stiffness modulates with disease, development, and injury. Static tissue-mimicking materials, or materials that cannot alter stiffness once cells are plated, are predominately used to investigate the effects of tissue stiffness on cell functions. While information gathered from static studies is valuable, these studies are not indicative of the dynamic nature of the cellular microenvironment in vivo. To better address the effects of dynamic stiffness on cell function, we developed a DNA-crosslinked polyacrylamide hydrogel system (DNA gels). Unlike other dynamic substrates, DNA gels have the ability to decrease or increase in stiffness after fabrication without stimuli. DNA gels consist of DNA crosslinks that are polymerized into a polyacrylamide backbone. Adding and removing crosslinks via delivery of single-stranded DNA allows temporal, spatial, and reversible control of gel elasticity. We have shown in previous reports that dynamic modulation of DNA gel elasticity influences fibroblast and neuron behavior. In this report and video, we provide a schematic that describes the DNA gel crosslinking mechanisms and step-by-step instructions on the preparation DNA gels.

Our laboratory has developed DNA-crosslinked polyacrylamide hydrogels, a dynamic hydrogel system, to better understand the effects of modulating tissue stiffness on cell function. Here, we provide schematics, descriptions, and protocols to prepare these hydrogels.

Mechanobiology is an emerging scientific area that addresses the critical role of physical cues in directing cell morphology and function. For example, ...

Combining Single-molecule Manipulation and Imaging for the Study of Protein-DNA Interactions

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method offers the opportunity of investigating interactions occurring in solution (thus avoiding problems due to closeby surfaces as in other single molecule methods), controlling the DNA extension and tracking interaction dynamics as a function of both mechanical parameters and DNA sequence. The methods for establishing successful optical trapping and nanometer localization of single molecules are illustrated. We illustrate the experimental conditions allowing the study of interaction of lactose repressor (lacI), labeled with Atto532, with a DNA molecule containing specific target sequences (operators) for LacI binding. The method allows the observation of specific interactions at the operators, as well as one-dimensional diffusion of the protein during the process of target search. The method is broadly applicable to the study of protein-DNA interactions but also to molecular motors, where control of the tension applied to the partner track polymer (for example actin or microtubules) is desirable.

Here we describe the instrumentation and methods for detecting single fluorescently-labeled protein molecules interacting with a single DNA molecule suspended between two optically trapped microspheres.

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method ...

Real-time Imaging of Single Engineered RNA Transcripts in Living Cells Using Ratiometric Bimolecular Beacons

The growing realization that both the temporal and spatial regulation of gene expression can have important consequences on cell function has led to the development of diverse techniques to visualize individual RNA transcripts in single living cells. One promising technique that has recently been described utilizes an oligonucleotide-based optical probe, ratiometric bimolecular beacon (RBMB), to detect RNA transcripts that were engineered to contain at least four tandem repeats of the RBMB target sequence in the 3&#8217;-untranslated region. RBMBs are specifically designed to emit a bright fluorescent signal upon hybridization to complementary RNA, but otherwise remain quenched. The use of a synthetic probe in this approach allows photostable, red-shifted, and highly emissive organic dyes to be used for imaging. Binding of multiple RBMBs to the engineered RNA transcripts results in discrete fluorescence spots when viewed under a wide-field fluorescent microscope. Consequently, the movement of individual RNA transcripts can be readily visualized in real-time by taking a time series of fluorescent images. Here we describe the preparation and purification of RBMBs, delivery into cells by microporation and live-cell imaging of single RNA transcripts.

Ratiometric bimolecular beacons (RBMBs) can be used to image single engineered RNA transcripts in living cells. Here, we describe the preparation and purification of RBMBs, delivery of RBMBs into cells by microporation and fluorescent imaging of single RNA transcripts in real-time.

The growing realization that both the temporal and spatial regulation of gene expression can have important consequences on cell function has led to the ...

Studying DNA Looping by Single-Molecule FRET

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

This study presents a detailed experimental procedure to measure looping dynamics of double-stranded DNA using single-molecule Fluorescence Resonance Energy Transfer (FRET). The protocol also describes how to extract the looping probability density called the J factor.

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

Reduced-gravity Environment Hardware Demonstrations of a Prototype Miniaturized Flow Cytometer and Companion Microfluidic Mixing Technology

Until recently, astronaut blood samples were collected in-flight, transported to earth on the Space Shuttle, and analyzed in terrestrial laboratories. If humans are to travel beyond low Earth orbit, a transition towards space-ready, point-of-care (POC) testing is required. Such testing needs to be comprehensive, easy to perform in a reduced-gravity environment, and unaffected by the stresses of launch and spaceflight. Countless POC devices have been developed to mimic laboratory scale counterparts, but most have narrow applications and few have demonstrable use in an in-flight, reduced-gravity environment. In fact, demonstrations of biomedical diagnostics in reduced gravity are limited altogether, making component choice and certain logistical challenges difficult to approach when seeking to test new technology. To help fill the void, we are presenting a modular method for the construction and operation of a prototype blood diagnostic device and its associated parabolic flight test rig that meet the standards for flight-testing onboard a parabolic flight, reduced-gravity aircraft. The method first focuses on rig assembly for in-flight, reduced-gravity testing of a flow cytometer and a companion microfluidic mixing chip. Components are adaptable to other designs and some custom components, such as a microvolume sample loader and the micromixer may be of particular interest. The method then shifts focus to flight preparation, by offering guidelines and suggestions to prepare for a successful flight test with regard to user training, development of a standard operating procedure (SOP), and other issues. Finally, in-flight experimental procedures specific to our demonstrations are described.

Spaceflight blood diagnostics need innovation. Few demonstrations have been published illustrating in-flight, reduced-gravity health diagnostic technology. Here we present a method for construction and operation of a parabolic flight test rig for a prototype point-of-care flow-cytometry design, with components and preparation strategies adaptable to other setups.

Until recently, astronaut blood samples were collected in-flight, transported to earth on the Space Shuttle, and analyzed in terrestrial laboratories. If ...

A Proteoliposome-Based Efflux Assay to Determine Single-molecule Properties of Cl- Channels and Transporters

The last 15 years have been characterized by an explosion in the ability to overexpress and purify membrane proteins from prokaryotic organisms as well as from eukaryotes. This increase has been largely driven by the successful push to obtain structural information on membrane proteins. However, the ability to functionally interrogate these proteins has not advanced at the same rate and is often limited to qualitative assays of limited quantitative value, thereby limiting the mechanistic insights that they can provide. An assay to quantitatively investigate the transport activity of reconstituted Cl- channels or transporters is described. The assay is based on the measure of the efflux rate of Cl- from proteoliposomes following the addition of the K+ ionophore valinomycin to shunt the membrane potential. An ion sensitive electrode is used to follow the time-course of ion efflux from proteoliposomes reconstituted with the desired protein. The method is highly suited for mechanistic studies, as it allows for the quantitative determination of key properties of the reconstituted protein, such as its unitary transport rate, the fraction of active protein and the molecular mass of the functional unit. The assay can also be utilized to determine the effect of small molecule compounds that directly inhibit/activate the reconstituted protein, as well as to test the modulatory effects of the membrane composition or lipid-modifying reagents. Where possible, direct comparison between results obtained using this method were found to be in good agreement with those obtained using electrophysiological approaches. The technique is illustrated using CLC-ec1, a CLC-type H+/Cl- exchanger, as a model system. The efflux assay can be utilized to study any Cl- conducting channel/transporter and, with minimal changes, can be adapted to study any ion-transporting protein.

A Proteoliposome-Based Efflux Assay to Determine Single-molecule Properties of Cl- Channels and Transporters

Proteoliposomes are used to study purified channels and transporters reconstituted in a well-defined biochemical environment. An experimental procedure to measure efflux mediated by these proteins is illustrated. The steps to prepare proteoliposomes, perform the recordings, and analyze data to quantitatively determine the functional properties of the reconstituted protein are described.

The last 15 years have been characterized by an explosion in the ability to overexpress and purify membrane proteins from prokaryotic organisms as well as ...