This research was funded by Doris Duke Charitable Foundation, Burroughs Wellcome Fund, NIH R21DK080994, Duke Chancellor's pilot project fund, the Roche Foundation for Anemia Research and The Bill and Melinda Gates Foundation. G.L. is supported by Duke's UPGG and the NIH (Grant # 5R01AI090141-03) and K.A.W. by the NSF Graduate Research Fellowship Program.

1: Isolation of Small-sized RNAs from P. falciparum During the IDC
<ol>
	<li>Obtain malaria parasites in asexual culture29. 
	NOTE: The required culture size will vary based upon the desired application; however, a 10 ml culture at 3-5% parasitemia and 5% hematocrit provides ample RNA for real-time PCR (RT-PCR). The technique was initially optimized for asynchronous cultures, but when specific time points during the infection cycle are desired, ring-stage parasites can be synchronized by sorbitol synchronization no later than 10-12 hr post-invasion. Synchronization should be repeated after one cycle (approximately 48 hr)29 .</li>
	<li>Pool infected cells together (~5 x 109 RBCs at 3-5% parasitemia) and fill cold PBS to the top of the tube and centrifuge at 800 x g for 5 min without brake to pellet the red cells.</li>
	<li>After centrifugation, remove the supernatant carefully using an aspirating pipette, attached to a vacuum, since the erythrocytic pellet is easy to dislodge. Wash the pellet once more with cold 1x PBS.</li>
	<li>Resuspend cell pellet in cold 0.15% saponin (in 1x PBS) and place on ice for 30 min.</li>
	<li>Centrifuge cells at 1,500 x g for 12 min at 4 &#176;C, remove supernatant (which will be dark red in color) and resuspend pellet in cold PBS. Repeat this step once more. 
	NOTE: In order to ensure that the microRNAs present were reflective of microRNAs within parasites, and not erythrocytic contamination, a number of parasite isolation conditions were tested: 1) saponin lysis, 2) saponin lysis combined with RNaseA treatment of host cell miRNAs and 3) Methyl-beta-cyclodextrin treatment to remove the parasite from the host erythrocyte. All treatments gave similar results.</li>
	<li>Lyse the isolated parasite pellet using the recommended 600 &#181;l of lysis buffer. This volume of lysis buffer is sufficient for cultures up to ~30 ml at 2% hematocrit and 5% parasitemia. 
	NOTE: For larger parasite cultures, this volume can be increased. It is important to ensure complete lysis of the parasite pellet by thorough vortexing for at least 1 min. Also, for ease of extraction, the lysed samples can be transferred to a 1.7 ml microcentrifuge tube.</li>
	<li>Add 60 &#181;l, or 1/10 volume of the lysis buffer used in step 6, of homogenate additive (2 M sodium acetate, pH 4).</li>
	<li>Leave samples on ice for 10 min.</li>
	<li>Add 600 &#181;l, or a volume equal to the amount of lysis buffer added in step 6, of acid phenol choloroform to each sample and vortex for 1 min.</li>
	<li>Separate the aqueous and organic phases by centrifuging the samples at 10,000 x g for 5 min. This spin is longer than that suggested by the kit to ensure that all hemoglobin/hemozoin is in the organic phase.</li>
	<li>Collect the upper (aqueous) layer and transfer it to a fresh tube. Repeat steps 9 and 10 if the aqueous phase is white or (more likely) brown in color, which suggests protein contamination.</li>
	<li>Determine the volume of the resulting supernatant by pipette and then add 1.25 volumes of 100% ethanol (~800 &#181;l) and mix by inverting the 1.7 ml microcentrifuge tube 5 times.</li>
	<li>Pass each sample through a provided RNA-binding filter cartridge (several different of which are available commercially) by either centrifugation at 14,000 x g for 1 min or by using a vacuum manifold.</li>
	<li>Wash the filter cartridge with 700 &#181;l of the miRNA wash buffer 1 using a microcentrifuge, spinning at 14,000 x g for 1 min.</li>
	<li>Wash the filter cartridge with 500 &#181;l wash buffer 2/3 twice by centrifuging at 14,000 x g for 1 min each.</li>
	<li>Elute RNA with 100 &#181;l DEPC-water, which has been preheated to 95 &#186;C, in two washes of 50 &#181;l, centrifuging at 14,000 x g for 1 min each. Measure the concentration of RNA via UV absorbance at 260nm. 
	NOTE: An RNA gel (either TBE-urea acrylamide or denaturing formaldehyde agarose gel) can be used to assess the size distribution of the isolated RNAs. 
	NOTE: This RNA is suitable for analysis by microarray, RNA-sequencing, northern blot and ribonuclease protection assay.</li>
</ol>
2: Quantitation of Small-sized RNAs from P. falciparum During the IDC
<ol>
	<li>Determine the concentration of individual samples isolated in step 1 using UV spectrophotometry at 260 nm.</li>
	<li>Generate real-time PCR primers for the desired RNA species. For miRNA alone, we used premade miRNA qPCR assays, while for mRNAs or fusion miRNA-mRNA we designed primers for SYBR green. For the fusion RNAs, the forward primer was the miRNA sequence itself (miR-451: AAACCGTTACCATTACTGAGTT), while the reverse was a gene-specific primer ~100 bp downstream of the miRNA in the mRNA sequence (PKA-R: ATCGAACATGCTGTGAACAT).</li>
	<li>Make cDNA from the RNA samples using either a hairpin primer for miRNAs (use 20-40 ng of RNA) alone or random hexamers for mRNA and/or miRNA-mRNA fusion species (using 1 &#181;g of RNA). Mix RNA and primers for 5 min at 65 &#176;C, then cool to room temperature. Afterwards, add reverse transcriptase mix (0.5 &#181;l reverse transcriptase, 0.5 &#181;l RNase inhibitor, 1 &#181;l dNTPs (2.5 mM each), 4 &#181;l 5x buffer, 2 &#181;l 0.1M DTT, 1 &#181;l H2O).
	<ol>
		<li>Run samples on a thermocycler capable of detecting either SYBR green or TaqMan probes. SYBR green quantitative PCR30 for specific genes was run as a 3-step PCR, 95 &#176;C for 15 sec, lowest primer annealing temperature minus 5 &#176;C for 30 sec, and 68 &#176;C for 30 sec, for 40 cycles, using a commercial SYBR green master mix. miRNA real-time PCR was run as a two-step PCR, 95 &#176;C for 15 sec and 60 &#176;C for 1 min, for 40 cycles.</li>
		<li>Quantify assays using the &#916;&#916;Ct method and normalize them against either Rab GTPase (PF08_0110) or 18S rRNA 31.</li>
	</ol>
	</li>
</ol>
3: Introduction of Small RNAs into Malaria Parasites
<ol>
	<li>Pellet 300 &#181;l of red blood cells per transfection (250 &#181;l of RBCs, approximately 1.5 x 109 cells, will ultimately be used) in complete malaria media by centrifugation at 800 x g for 5 min at brake 1.</li>
	<li>Wash the erythrocytes twice with RPMI and resuspend in complete cytomix (120 mM KCl; 0.15 mM CaCl2; 10 mM K2HPO4/KH2PO4, pH 7.6; 25 mM HEPES, pH 7.6; 2 mM EGTA, pH 7.6; 5 mM MgCl2; pH adjusted with KOH) at 50% hematocrit after centrifuging at 800 x g for 5 min at brake 1.</li>
	<li>Transfer the cells to a 0.2 cm electroporation cuvette.</li>
	<li>Add 10 &#181;g, or appropriate amount, of custom synthetic oligonucleotides to the cuvettes and resuspend the cultures.</li>
	<li>Adjust the electroporator to 310 V/950 &#181;F and deliver a pulse to each cuvette.</li>
	<li>Resuspend the 300 &#181;l of RBCs within the cuvette in pre-warmed complete malaria media and plate them in 24 well plates and incubate at 37&#160;&#176;C in an airtight container with malaria blood gas mix (3% O2, 5% CO2).</li>
	<li>After 4 hr, infect transfected RBCs with synchronized late trophozoites to an approximate final parasitemia of 1%.</li>
	<li>Add freshly transfected RBCs every 4-6 days to infected cultures and determine the % parasitemia by FACS using YoYo-1 staining, as indicated in section 4.</li>
</ol>
4: Determination of Erythrocyte microRNAs Effect Upon Parasite Infection Rate
<ol>
	<li>Take 100 &#181;l of resuspended culture by micropipettor and place in a 1.7 ml microcentrifuge tube. Wash twice with 1 ml of 1x PBS and centrifuge in a tabletop microcentrifuge by centrifugation at 800 x g for 5 min.</li>
	<li>Resuspend pellet in 1 ml of 0.025% glutaraldehyde. Incubate samples for 20 min at RT. 
	NOTE: samples can be stored here for several weeks at 4 &#176;C. Afterwards, pellet the infected RBCs by centrifugation at 800 x g for 5 min. Wash twice with 1 ml of 1x PBS.</li>
	<li>Resuspend pellet in 1 ml of 0.015% saponin. Incubate at 4 &#176;C for 15 min. Pellet infected RBCs by centrifugation at 800 x g for 5 min. Wash twice with 1 ml of 1x PBS. Repeat.4.3. Resuspend cells in 1 ml of 1x PBS containing 1 &#181;l (1,000X) DNA stain.</li>
	<li>Determine the degrees of parasitemia on a flow cytometer, at 488 nM excitation and ~530 nM (FL-1) emission.</li>
	<li>First, gate the flow cytometer based upon FSC and SSC to focus on RBCs. Then measure the degrees of parasitemia (infected RBCs) in the gated RBC by fluorescence in the FL-1 channel. 
	NOTE: later stage parasites are 10X more fluorescent than earlier stage parasites, and ~100X above uninfected RBCs. Also, collecting at low speed tends to reduce noise. Finally, this approach has been compared to 3H-hypoxanthine incorporation and Giemsa staining, both as reported previously13, and all techniques gave similar results.</li>
</ol>
5: Biotin-tagging and Elution of miRNA-mRNA Fusion Products
<ol>
	<li>Directly order custom synthetic RNA oligonucleotides with desthiobiotin (Db-) covalently linked to the 5&#39; end.</li>
	<li>Transfect uninfected RBCs with Desthiobiotin-conjugated (Db-) miRNA and unmodified miRNA (negative control), as indicated in step 3.</li>
	<li>Infect transfected RBCs with P. falciparum parasites to a starting parasitemia of 0.5% (step 1.1).</li>
	<li>Extract parasite RNA 4 days (96 hr) later as described above in step 1.</li>
	<li>Incubate 10 &#181;g of parasite RNA with 50 &#181;l packed streptavidin beads, added via micropipette, and rotate on a microcentrifuge tube rotator for 1 hour at 4 &#176;C.</li>
	<li>Pellet the beads at 800 x g for 30 sec and wash with 20 mM KCl and 1/1,000 RNase Inhibitor.</li>
	<li>Elute RNAs from the beads by competition with 2 mM biotin and with 200 &#181;l RNA capture elution buffer (20 mM KCl, 1/1,000 RNase Inhibitor and 2 mM biotin) at 4 &#176;C overnight with rotation.</li>
	<li>Determine the degree of enrichment of indicated P. falciparum transcripts using SYBR green qRT-PCR, and microRNA enrichment (positive control) by TaqMan qPCR as indicated in step 2.</li>
</ol>
6: Polysome Separation to Determine the Ribosomal Occupancy of P. falciparum
<ol>
	<li>Place 5 ml of 15% sucrose solution (400 mM potassium acetate, 25 mM potassium HEPES, pH 7.2, 15 mM magnesium acetate, 200 &#181;M cycloheximide, 1 mM DTT, 1 mM PMSF, 40 U/ml RNase Inhibitor, and 15% sucrose) into a SW41 ultracentrifuge tube (14 x 89 mm).</li>
	<li>Using a 5 ml syringe, add 5 ml of 50% sucrose solution (400 mM potassium acetate, 25 mM potassium HEPES, pH 7.2, 15 mM magnesium acetate, 200 &#181;M cycloheximide, 1 mM DTT, 1 mM PMSF, 40 U/ml RNase Inhibitor, and 50% sucrose) underneath the 15% sucrose using a long steel needle, then remove the needle.</li>
	<li>Seal the top of the gradient tube with Parafilm, tilt the tube slowly onto its side, in a stable position to prevent rolling, so it is lying horizontally on the tabletop. Keep the tube on its side for at least 2 hr. While waiting, start with step 6.5.</li>
	<li>After 2 hr, slowly tilt the tube back upright and transfer the tube to ice, allowing it to cool for at least 15 min prior to sample loading (step 14).</li>
	<li>Collect enough Plasmodium-infected blood stage culture to generate 100-500 &#181;g of total RNA, or roughly a 100 ml asynchronous culture at 3-5% parasitemia. Add 1/10th that volume of culture medium containing 10x (2 mM) cycloheximide (CHX) and incubate at 37 &#176;C for 10 min.
	<ol>
		<li>Pellet cultures by centrifugation at 500 x g for 7 min with the centrifuge (brake 1), then wash twice with room temperature 1x PBS containing 200 &#181;M CHX. Resuspend the parasite cultures in 1x PBS containing 200 &#181;M CHX and store on ice.</li>
	</ol>
	</li>
	<li>Estimate the volume of the RBC pellet. Add lysis buffer (400 mM potassium acetate, 25 mM potassium HEPES, pH 7.2, 15 mM magnesium acetate, 200 &#181;M CHX, 1 mM DTT, 1 mM PMSF, 40 U/ml RNase Inhibitor, 1% (v/v) IGEPAL CA-630, and 0.5% (w/v) DOC) to the RBC pellet to a final volume of 4.25 ml. Incubate the lysate at 4 &#176;C for 10 min while rotating.</li>
	<li>Transfer the lysate to microcentrifuge tubes, and then centrifuge the samples in a microcentrifuge at 16,000 x g and 4 &#176;C for 10 min.</li>
	<li>Prepare sucrose cushions by pipetting 1.25 ml of cold 0.5 M sucrose cushion solution (400 mM potassium acetate, 25 mM potassium HEPES, pH 7.2, 15 mM magnesium acetate, 200 &#181;M cycloheximide, 1 mM DTT, 1 mM PMSF, 40 U/ml RNase Inhibitor, and 0.5 M sucrose) into a SW55 ultracentrifuge tube (13 x 51 mm).</li>
	<li>Carefully layer 3.75 ml of lysate supernatant (from step 7) on top of the sucrose cushion using a syringe and small (~27) gauge needle. Store the remaining lysate (~500 &#181;l) at -80 &#176;C to extract total RNA levels, as indicated in section 1.</li>
	<li>Load the samples into an ultracentrifuge rotor, pre-chilled to 4 &#176;C, which can hold 13.2 ml tubes. Centrifuge the samples at 366,000 x g and 4 &#176;C for 146 min.</li>
	<li>Using a pipette, transfer the supernatant into a 15mL conical tube. Store the supernatant at -80 &#176;C for RNA isolation of free (unbound by ribosomes) RNAs.</li>
	<li>Resuspend the ribosome pellet in 500 &#181;l of ribosome resuspension buffer (400 mM potassium acetate, 25 mM potassium HEPES, pH 7.2, 15 mM magnesium acetate, 200 &#181;M cycloheximide, 1 mM DTT, 1 mM PMSF, and 40 U/ml RNase Inhibitor) by pipetting for 5 min.</li>
	<li>Centrifuge the samples in a microcentrifuge at 16,000 x g and 4&#160;&#176;C for 10 min.</li>
	<li>While keeping the gradient from step #4 on ice, remove the Parafilm, then carefully layer the ribosome suspension on top of the gradient using a syringe and small (~27) gauge needle.</li>
	<li>Load the tube into a pre-chilled ultracentrifuge rotor and centrifuge the loaded gradients at 200,000 x g and 4&#160;&#176;C for 180 min. When the spin is completed, store centrifuged gradients at 4 &#176;C until ready to load onto the fractionator.</li>
	<li>Load an empty ultracentrifuge tube into the gradient fractionator (this can be a tube used in a previous run), then wash with RNAse-free water for 5 min at 100 x 10 speed.</li>
	<li>During the wash in step 6.16, set the sensitivity of the UV absorbance detector. A good starting sensitivity is 0.2, but this may have to be adjusted in later runs depending on the A254 signal (which varies based on parasite number, etc.).</li>
	<li>Once the detector sensitivity is set, set the baseline signal to zero while water is flowing through the detector.</li>
	<li>After washing the fraction collector, reverse the fluid flow until the lines are empty and then remove the empty ultracentrifuge tube.</li>
	<li>Run 60% sucrose solution through the fractionator until it exits the needle apparatus.</li>
	<li>Insert the tube containing the first gradient at the top of the loading chamber and tighten the seal, taking care not to over-tighten. Then, pierce the bottom of the tube with the needle.</li>
	<li>Reset the fluid flow speed to 12.5 x 10 (controlled by the flow speed control knob on the front of the pump), then set the automated fraction collector to collect 18 sec fractions (~330 &#181;l/fraction) in microcentrifuge tubes.</li>
	<li>Start forward flow of the 60% sucrose solution.</li>
	<li>When the first drop of the gradient solution drops into the microcentrifuge tube, immediately begin both fraction collection and live recording of the A254 signal.</li>
	<li>Once a sharp drop is observed in the A254 signal, corresponding to the interface between the 50% and 60% sucrose solutions, stop both the fluid flow and A254 recording.</li>
	<li>Store the gradient fractions at -80&#160;&#176;C for later use.</li>
	<li>Reverse the fluid flow at 100 x 10 speed until the 60% sucrose solution empties out of the ultracentrifuge tube.</li>
	<li>If there are additional gradients to fractionate, remove the empty ultracentrifuge tube from the loading chamber and restart from step 6.21. If all samples are completed, wash the apparatus as was performed in steps 6.16 and 6.19.</li>
</ol>

<ol>
	<li>World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> World Malaria Report. , (2014).</li><li>Livincstone, F. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+human+polymorphisms.">Malaria and human polymorphisms.</a> Annu Rev Genet. 5, 33-64 (1971).</li><li>Nagel, R. L., Roth, E. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Malaria+and+red+cell+genetic+defects.">Malaria and red cell genetic defects.</a> Blood. 74, 1213-1221 (1989).</li><li>Aidoo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protective+effects+of+the+sickle+cell+gene+against+malaria+morbidity+and+mortality.">Protective effects of the sickle cell gene against malaria morbidity and mortality.</a> Lancet. 359, 1311-1312 (2002).</li><li>Tiffert, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+hydration+state+of+human+red+blood+cells+and+their+susceptibility+to+invasion+by+Plasmodium+falciparum.">The hydration state of human red blood cells and their susceptibility to invasion by Plasmodium falciparum.</a> Blood. 105, 4853-4860 (2005).</li><li>Fairhurst, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+display+of+PfEMP-1+on+erythrocytes+carrying+haemoglobin+C+may+protect+against+malaria.">Abnormal display of PfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria.</a> Nature. 435, 1117-1121 (2005).</li><li>Cyrklaff, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemoglobins+S+and+C+interfere+with+actin+remodeling+in+Plasmodium+falciparum-infected+erythrocytes.">Hemoglobins S and C interfere with actin remodeling in Plasmodium falciparum-infected erythrocytes.</a> Science. 334, 1283-1286 (2011).</li><li>Friedman, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Erythrocytic+mechanism+of+sickle+cell+resistance+to+malaria.">Erythrocytic mechanism of sickle cell resistance to malaria.</a> Proceedings of the National Academy of Sciences of the United States of America. 75, 1994-1997 (1978).</li><li>Pasvol, G., Weatherall, D. J., Wilson, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mechanism+for+the+protective+effect+of+haemoglobin+S+against+P.+falciparum+malaria.">Cellular mechanism for the protective effect of haemoglobin S against P. falciparum malaria.</a> Nature. 274, 701-703 (1978).</li><li>Lecellier, C. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cellular+microRNA+mediates+antiviral+defense+in+human+cells.">A cellular microRNA mediates antiviral defense in human cells.</a> Science. 308, 557-560 (2005).</li><li>Niu, Q. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+artificial+miroRNAs+in+transgenic+Arabidopsis+thaliana+confers+virus+resistance.">Expression of artificial miroRNAs in transgenic Arabidopsis thaliana confers virus resistance.</a> Nature biotechnology. 24, 1420-1428 (2006).</li><li>Zhao, G., Yu, D., Weiss, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+in+erythropoiesis.">MicroRNAs in erythropoiesis.</a> Curr Opin Hematol. 17, 155-162 (2010).</li><li>Lee, Y. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LIN28B-mediated+expression+of+fetal+hemoglobin+and+production+of+fetal-like+erythrocytes+from+adult+human+erythroblasts+ex+vivo.">LIN28B-mediated expression of fetal hemoglobin and production of fetal-like erythrocytes from adult human erythroblasts ex vivo.</a> Blood. 122, 1034-1041 (2013).</li><li>Sangokoya, C., Doss, J. F., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iron-responsive+miR-485-3p+regulates+cellular+iron+homeostasis+by+targeting+ferroportin.">Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin.</a> PLoS genetics. 9, e1003408 (2013).</li><li>Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genomic+analysis+of+erythrocyte+microRNA+expression+in+sickle+cell+diseases.">The genomic analysis of erythrocyte microRNA expression in sickle cell diseases.</a> PLoS ONE. 3, e2360 (2008).</li><li>Sangokoya, C., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=microRNA+miR-144+modulates+oxidative+stress+tolerance+and+associates+with+anemia+severity+in+sickle+cell+disease.">microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease.</a> Blood. 116, 4338-4348 (2010).</li><li>Deitsch, K., Driskill, C., Wellems, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+malaria+parasites+by+the+spontaneous+uptake+and+expression+of+DNA+from+human+erythrocytes.">Transformation of malaria parasites by the spontaneous uptake and expression of DNA from human erythrocytes.</a> Nucleic acids research. 29, 850-853 (2001).</li><li>Liang, X. H., Haritan, A., Uliel, S., Michaeli, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=trans+and+cis+splicing+in+trypanosomatids:+mechanism,+factors,+and+regulation.">trans and cis splicing in trypanosomatids: mechanism, factors, and regulation.</a> Eukaryotic cell. 2, 830-840 (2003).</li><li>Baum, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+genetics+and+comparative+genomics+reveal+RNAi+is+not+functional+in+malaria+parasites.">Molecular genetics and comparative genomics reveal RNAi is not functional in malaria parasites.</a> Nucleic acids research. 37, 3788-3798 (2009).</li><li>Hall, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+survey+of+the+Plasmodium+life+cycle+by+genomic,+transcriptomic,+and+proteomic+analyses.">A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses.</a> Science. 307, 82-86 (2005).</li><li>Caro, F., Ahyong, V., Betegon, M., DeRisi, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+regulatory+dynamics+of+translation+in+the+asexual+blood+stages.">Genome-wide regulatory dynamics of translation in the asexual blood stages.</a> eLife. 3, (2014).</li><li>Oehring, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organellar+proteomics+reveals+hundreds+of+novel+nuclear+proteins+in+the+malaria+parasite+Plasmodium+falciparum.">Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum.</a> Genome biology. 13, R108 (2012).</li><li>Lasonder, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Plasmodium+falciparum+proteome+by+high-accuracy+mass+spectrometry.">Analysis of the Plasmodium falciparum proteome by high-accuracy mass spectrometry.</a> Nature. 419, 537-542 (2002).</li><li>Bozdech, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcriptome+of+the+intraerythrocytic+developmental+cycle+of+Plasmodium+falciparum.">The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum.</a> PLoS biology. 1, E5 (2003).</li><li>Gardner, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+human+malaria+parasite+Plasmodium+falciparum.">Genome sequence of the human malaria parasite Plasmodium falciparum.</a> Nature. 419, 498-511 (2002).</li><li>Zhang, M., Joyce, B. R., Sullivan, W. J., Nussenzweig, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+Plasmodium+and+toxoplasma+parasites.">Translational control in Plasmodium and toxoplasma parasites.</a> Eukaryotic cell. 12, 161-167 (2013).</li><li>Lacsina, J. R., LaMonte, G., Nicchitta, C. V., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+of+the+malaria+parasite+Plasmodium+falciparum.">Polysome profiling of the malaria parasite Plasmodium falciparum.</a> Molecular and biochemical parasitology. 179, 42-62 (2011).</li><li>Bunnik, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+profiling+reveals+translational+control+of+gene+expression+in+the+human+malaria+parasite+Plasmodium+falciparum.">Polysome profiling reveals translational control of gene expression in the human malaria parasite Plasmodium falciparum.</a> Genome biology. 14, R128 (2013).</li><li>LaMonte, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translocation+of+sickle+cell+erythrocyte+microRNAs+into+Plasmodium+falciparum+inhibits+parasite+translation+and+contributes+to+malaria+resistance.">Translocation of sickle cell erythrocyte microRNAs into Plasmodium falciparum inhibits parasite translation and contributes to malaria resistance.</a> Cell host &amp; microbe. 12, 187-199 (2012).</li><li>Lambros, C., Vanderberg, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synchronization+of+Plasmodium+falciparum+erythrocytic+stages+in+culture.">Synchronization of Plasmodium falciparum erythrocytic stages in culture.</a> The Journal of parasitology. 65, 418-420 (1979).</li><li>Bourgeois, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+real-time+PCR+methods+with+blood+smears+and+rapid+diagnostic+test+in+Plasmodium+sp.+infection.">Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection.</a> Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 16, 1305-1311 (2010).</li><li>Abruzzo, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Validation+of+oligonucleotide+microarray+data+using+microfluidic+low-density+arrays:+a+new+statistical+method+to+normalize+real-time+RT-PCR+data.">Validation of oligonucleotide microarray data using microfluidic low-density arrays: a new statistical method to normalize real-time RT-PCR data.</a> Biotechniques. 38, 785-792 (2005).</li><li>Sangokoya, C., LaMonte, G., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+microRNAs+of+human+mature+erythrocytes.">Isolation and characterization of microRNAs of human mature erythrocytes.</a> Methods in molecular biology. 667, 193-203 (2010).</li><li>Rathjen, T., Nicol, C., McConkey, G., Dalmay, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+short+RNAs+in+the+malaria+parasite+and+its+red+blood+cell+host.">Analysis of short RNAs in the malaria parasite and its red blood cell host.</a> FEBS Lett. 580, 5185-5188 (2006).</li><li>Xue, X., Zhang, Q., Huang, Y., Feng, L., Pan, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=No+miRNA+were+found+in+Plasmodium+and+the+ones+identified+in+erythrocytes+could+not+be+correlated+with+infection.">No miRNA were found in Plasmodium and the ones identified in erythrocytes could not be correlated with infection.</a> Malar J. 7, 47 (2008).</li></ol>

The authors have no competing financial interests to declare.

HbS is one of the most common hemoglobin variants in malaria endemic areas, largely because it provides protection against severe malaria caused by P. falciparum. The techniques needed to characterize the role of human microRNA in the gene regulation of P. falciparum are detailed throughout this manuscript. By extracting total RNA in such a way as to include all small RNAs, and by performing a relatively straightforward parasite lysis procedure, these fusion RNAs were able to be identified through a var...

Malaria, caused by apicomplexan parasites of the genus Plasmodium, is the most common human parasitic disease, globally infecting approximately 200 million people each year and causing around 600,000 deaths1. Of the five Plasmodium species that infect humans, the most relevant to human disease are P. falciparum and P. vivax, due to their widespread distributions and potential for severe malaria complications. The life cycle of the malaria parasite requires infection of both mosquitoes and humans. When an infected mosquito bites a human, the parasites travel through the bloodstream to the liver, where an initial round of replication occurs. After merozoites rupture from the host hepatocyte, they infect nearby red blood cells, initiating either asexual or sexual replication. The asexual stage of replication, which lasts 48 hr in P. falciparum, is the focus of this study since it is both the source of most malaria symptoms and is easily recapitulated in vitro.
While a number of public health initiatives, including improved anti-malarial therapies, have somewhat reduced the burden of malaria globally, the continuing emergence of drug resistant parasites presents a problem for malaria control efforts. One area which may suggest new therapeutic approaches is the study on how various genetic variants confer resistance to malaria. In malaria-endemic regions, a variety of erythrocytic polymorphisms are quite common2,3. These mutations, with sickle cell being perhaps the most prominent, are often associated with substantial resistance to the onset of symptomatic malaria infection4. The underlying mechanisms by which they cause erythrocytes to resist malaria infection are incompletely understood. Parasitized erythrocytes with hemoglobin mutations are subject to enhanced phagocytosis through enhanced cellular rigidity and dehydration, which is associated with decreased invasion by P. falciparum5. The HbC allele also affects protein expression at the erythrocyte surface and with the remodeling of the cytoskeleton, further inhibiting parasite development6,7. Finally, P. falciparum grows poorly within homozygous sickle (HbSS) erythrocytes8,9 in vitro, suggesting intrinsic erythrocytic factors of malaria resistance. However, while all of these mechanisms appear to play a role, they do not fully explain the mechanisms behind sickle cell resistance to malaria.
One potential set of erythrocytic factors which remain poorly understood is the large pool of miRNA present within mature erythrocytes. MicroRNAs are small non-coding RNAs, 19-25 nt in size, which mediate translation and/or stability of target mRNAs by base pairing within the 3&#39; UTR. They have been implicated in the control of mammalian immune responses, including the suppression of virus replication10, and were shown to confer resistance to viruses in plants They have also been shown to regulate several erythrocytic processes, including erythropoiesis11,12 and iron metabolism13. Previous studies identified an abundant and diverse population of erythrocytic miRNAs, whose expression was dramatically altered in HbSS erythrocytes14,15. Since mature erythrocytes lack active transcription and translation, the functional role of these erythrocyte miRNAs remains unclear. As significant material exchange occurs between the host cell and P. falciparum during the intraerythrocytic developmental cycle (IDC)16, it was speculated that the altered miRNA profile within HbS erythrocytes may directly contribute to cell-intrinsic malaria resistance.
These studies ultimately led to the development of a pipeline to isolate, identify and functionally study the role of human miRNA within the malaria parasite, P. falciparum, which indicated that those host/human miRNAs ultimately covalently fuse and then translationally repress parasite mRNA transcripts17. This provided an example of the first cross-species chimeric transcripts formed by trans-splicing and implicates that this miRNA-mRNA fusion could be occurring in other species, including other parasites. All trypanosome mRNAs are trans-spliced with a splice-leader (SL) to regulate the separation of polycistronic transcripts18. Since P. falciparum lacks orthologs for Dicer/Ago19,20, it is possible that erythrocyte miRNAs hijack similar SL machinery in P. falciparum to integrate into target genes. Recent studies in P. falciparum have in fact indicated the presence of 5&#39; splice leader sequences21. This study details the methods that led to the discovery of human-parasite miRNA-mRNA fusion transcripts, including both transcriptomic and translational regulation techniques. The overall goals of these methods are to investigate the effects of small RNAs in the gene regulation, phenotypes and translation potential of P. falciparum transcripts.
The initial identification of human-parasite chimeric transcripts relied upon usage of RNA analysis techniques, such as real-time PCR, transcriptome sequencing and EST library capture, which included both total and small RNAs, rather than using techniques which only isolated small RNAs. Isolating all RNA together in one large pool, rather than separately, allowed the identification of both translocated human small RNAs in the parasite as well as the presence of these small RNA sequences as part of a larger sequence. This then required an analysis of the translation state of these fusion mRNAs to determine the functional consequences of these fusions.
While extensive efforts on characterization of the parasite&#39;s genome and transcriptome have added to the understanding of the parasite&#39;s biology22-25, far less is known about the translational regulation of the mRNA transcriptome across the life cycle of P. falciparum26. This limited understanding of the parasite&#39;s proteome has hindered both understanding of the parasite&#39;s biology and the ability to identify new targets for the next generation of anti-malarial therapeutics. This gap in the understanding of the parasite&#39;s cellular biology has persisted largely due to the lack of adequate techniques to investigate translational regulation in P. falciparum. One recent paper described the use of ribosomal footprinting of P. falciparum to determine the global translation status21. One well established measurement of translational potential of transcripts is the number of associated ribosomes determined by polysome profiling. However, when this technique is applied to P. falciparum, it is unable to recover most polysomes and captures predominantly monosomes. Recently, several groups27,28 have optimized P. falciparum polysome techniques by lysing the erythrocyte and parasite simultaneously to preserve the polysomes and characterize the ribosomal occupancy and translational potential of these malaria parasites during their asexual development in host red cells28.
Collectively, these methods demonstrate that the observed fusion of human miRNA and parasite mRNAs modulates parasite protein translation of those fusion mRNAs, which was demonstrated using previously reported methods27, and is a major determinant of malaria resistance in HbAS and HbSS erythrocytes17. These methods would be useful in any system looking to identify and functionally explore RNA splicing events, whether those fusion RNAs are within P. falciparum or other eukaryotic systems.

<table border="0" cellpadding="0" cellspacing="0" width="651">
	<tbody>
		<tr height="28">
			<td height="28" style="height:28px;width:651px;">REAGENTS-All reagents must be RNAse-free.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Diethyl pyrocarbonate (DEPC; Sigma, cat. no. D5758)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DEPC-treated water (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Yoyo-1 DNA fluorescent dye (Thermo Fisher)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Gene Pulser II (or comparible) electroporator (Bio-Rad)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.2 cm Electroporation cuvettes</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">4 M potassium acetate (Mallinckrodt, cat. no. 6700)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2 M potassium HEPES (pH 7.2; Sigma, cat. no. H0527)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M magnesium acetate (Sigma, cat. no. M-2545)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M dithiothreitol (DTT; Research Products International, cat. no. D11000)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">100 mM phenylmethylsulfonate fluoride (PMSF; dissolved in isopropanol; Sigma, cat. no. P7626)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% (v/v) Igepal CA-630 (Sigma-Aldrich, cat. no. I3021)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% (w/v) sodium deoxycholate (DOC; Sigma, cat. no. D-6750)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Cycloheximide (CHX; Sigma, cat. no. C-7698)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sucrose (Mallinckrodt, cat. no. 8360-04)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNAseOUT (Invitrogen, cat. no. 100000840)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RPMI-1640 w/ L-glutamine (Cellgro, cat. no. 10-040-CV)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10% AlbuMAX I (w/v in sterile water) (Invitrogen, cat. no. 11020-039)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Gentamicin (Gibco, cat. no. 15750-060))</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HT supplement (100x) (Invitrogen, cat. no. 11067030)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">45% (w/v) sucrose (Sigma, cat no. G8769)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 M HEPES buffer (Gibco, cat. no. 15630-080)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1x phosphate buffered saline (PBS; Cellgro, cat. no. 2109310CV)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Corning 500 ml vacuum filter flask (VWR, cat. no. 430769)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Glass slides (VWR, cat. no. 48311-702)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Giemsa stain (50X) (VWR, cat no. m708-01)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">mirVana miRNA isolation kit (Ambion, ThermoFisher Scientific).</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5&#39; Biotin conjugated mature miRNA (sequence varies by miRNA of interest) (Dharmacon)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Biotin powder (Sigma-Aldrich)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1M Potassium Chloride</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptavidin Sepharose High Performance Beads (GE Healthcare)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ribosome resuspension buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Lysis buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% (w/v) sucrose gradient solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50% (w/v) sucrose gradient solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 M sucrose cushion (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">60% (w/v) sucrose chase solution (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA capture Wash Buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Elution Buffer (see REAGENT SETUP)</td>
		</tr>
		<tr height="28">
			<td height="28" style="height:28px;">REAGENT SETUP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Solutions</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">500 ml RPMI-1640 w/ L-glutamine</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 ml gentamicin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5 ml HT supplement</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2.5 ml 45% glucose</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">25 ml 10% AlbuMAX I</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">12.5 ml 1 M HEPES</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sterile filter with 0.2 mm vacuum filter flask.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Plasmodium cell culture media containing 10x CHX</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as Plasmodium cell culture media above, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2 mM cycloheximide</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Media is prepared as normal, then add CHX to a final concentration of 2 mM and filter.&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1x PBS containing cycloheximide</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Cycloheximide is added fresh to 1x PBS to a final concentration of 200 mM, and kept at 4 OC until use.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ribosome resuspension buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">400 mM potassium acetate</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">25 mM potassium HEPES, pH 7.2</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15 mM magnesium acetate</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">200 mM cycloheximide (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM DTT (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 mM PMSF (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">40 U/ml RNaseOUT (add fresh)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Lysis buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as ribosome resuspension buffer above, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% (v/v) Igepal CA-630</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5% (w/v) DOC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sucrose solutions</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as ribosome resuspension buffer above, with the addition of varying amounts of sucrose:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">15% (w/v) sucrose to make 15% sucrose gradient solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">50% (w/v) sucrose to make 50% sucrose gradient solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.5 M sucrose to make 0.5 M sucrose cushion</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">As above, cycloheximide, DTT, PMSF, and RNaseOUT must be added fresh.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">The 60% sucrose chase solution requires only sucrose and water, no other components</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">60% (w/v) sucrose in DEPC-treated water to make 60% sucrose chase solution</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Capture Wash Buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">20mM&#160; KCl</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5unit/ml Rnase Out (Invitrogen)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">RNA Capture Elution Buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Same recipe as RNA Capture Wash Buffer, with the addition of:</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">2mM Biotin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
		</tr>
		<tr height="28">
			<td height="28" style="height:28px;">EQUIPMENT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SW55 Ti ultracentrifuge rotor (Beckman, cat. no. 342194)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SW41 Ti ultracentrifuge rotor (Beckman, cat. no. 331362)</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Ultra-ClearTM &#189; x 2 in (13 x 51 mm) ultracentrifuge tubes for the SW55 (Beckman, cat. no. 344057)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Polyallomer 9/16 x 3 &#189; in (14 x 89 mm) ultracentrifuge tubes for the SW41 (Beckman, cat. no. 331372)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">L8-80M ultracentrifuge (Beckman)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Steel blunt syringe needle, 4 inch, 16G (Aldrich, cat. no. Z261378)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1 ml syringe with 27G&#189; needle (Becton Dickinson, cat no. 309623)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5 ml syringe (Becton Dickinson, cat. no. 309646)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Parafilm</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Tube rotator, end-over-end</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microcentrifuge, refrigerated</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Density gradient fractionation system (Teledyne Isco, cat. no. 69-3873-179)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">TracerDAQ (Measurement Computing)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Eppendorf 5810R centrifuge</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Eppendorf A-4-81 rotor (Eppendorf, cat. no. 022638807)</td>
		</tr>
	</tbody>
</table>

methods to investigate the regulatory role of small rnas and ribosomal occupancy of plasmodium falciparum

The genetic variation responsible for the sickle cell allele (HbS) enables erythrocytes to resist infection by the malaria parasite, P. falciparum. The molecular basis of this resistance, which is known to be multifactorial, remains incompletely understood. Recent studies found that the differential expression of erythrocyte microRNAs, once translocated into malaria parasites, affect both gene regulation and parasite growth. These miRNAs were later shown to inhibit mRNA translation by forming a chimeric RNA transcript via 5&#39; RNA fusion with discreet subsets of parasite mRNAs. Here, the techniques that were used to study the functional role and putative mechanism underlying erythrocyte microRNAs on the gene regulation and translational potential of P. falciparum, including the transfection of modified synthetic microRNAs into host erythrocytes, will be detailed.&#160; Finally, a polysome gradient method is used to determine the extent of translation of these transcripts. Together, these techniques allowed us to demonstrate that the dysregulated levels of erythrocyte microRNAs contribute to cell-intrinsic malaria resistance of sickle erythrocytes.

Global profiling of human microRNA in P. falciparum
The techniques presented here were used to extract microRNAs from parasites in a variety of conditions. One thing to note is that RNA extractions for uninfected RBCs were performed as indicated in32, which often served as a reference point for the microRNA data presented in both this article and the original study29. Those previous studies also demonstrated that HbSS erythrocytes possessed far greater levels of ...

Watch this Scientific Journal Video about Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum at JoVE.com

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts.

Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

The genetic variation responsible for the sickle cell allele (HbS) enables erythrocytes to resist infection by the malaria parasite, P. falciparum. The ...

methods-to-investigate-regulatory-role-small-rnas-ribosomal-occupancy

Research

JoVE Journal

Immunology and Infection

8.8K Görüntüleme.  Duke University School of Medicine. Human microRNAs translocate from host erythrocytes to Plasmodium falciparum parasites. Here, the techniques used to transfect synthetic microRNAs into host erythrocytes and isolate all RNAs from P. falciparum are described. In addition, this paper will detail a method of polysome isolation in P. falciparum to determine the ribosomal occupancy and translational potential of parasite transcripts. 

Video: Methods to Investigate the Regulatory Role of Small RNAs and Ribosomal Occupancy of Plasmodium falciparum

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the disease, is characterised by an accumulation of Plasmodium falciparum infected red blood cells (iRBC) at pigmented trophozoite stage in the microvasculature of the brain2-4. This microvessel obstruction (sequestration) leads to acidosis, hypoxia and harmful inflammatory cytokines (reviewed in 5). Sequestration is also found in most microvascular tissues of the human body2, 3. The mechanism by which iRBC attach to the blood vessel walls is still poorly understood.
The immortalized Human Brain microvascular Endothelial Cell line (HBEC-5i) has been used as an in vitro model of the blood-brain barrier6. However, Plasmodium falciparum iRBC attach only poorly to HBEC-5i in vitro, unlike the dense sequestration that occurs in cerebral malaria cases. We therefore developed a panning assay to select (enrich) various P. falciparum strains for adhesion to HBEC-5i in order to obtain populations of high-binding parasites, more representative of what occurs in vivo.
A sample of a parasite culture (mixture of iRBC and uninfected RBC) at the pigmented trophozoite stage is washed and incubated on a layer of HBEC-5i grown on a Petri dish. After incubation, the dish is gently washed free from uRBC and unbound iRBC. Fresh uRBC are added to the few iRBC attached to HBEC-5i and incubated overnight. As schizont stage parasites burst, merozoites reinvade RBC and these ring stage parasites are harvested the following day. Parasites are cultured until enough material is obtained (typically 2 to 4 weeks) and a new round of selection can be performed. Depending on the P. falciparum strain, 4 to 7 rounds of selection are needed in order to get a population where most parasites bind to HBEC-5i. The binding phenotype is progressively lost after a few weeks, indicating a switch in variant surface antigen gene expression, thus regular selection on HBEC-5i is required to maintain the phenotype.
In summary, we developed a selection assay rendering P. falciparum parasites a more "cerebral malaria adhesive" phenotype. We were able to select 3 out of 4 P. falciparum strains on HBEC-5i. This assay has also successfully been used to select parasites for binding to human dermal and pulmonary endothelial cells. Importantly, this method can be used to select tissue-specific parasite populations in order to identify candidate parasite ligands for binding to brain endothelium. Moreover, this assay can be used to screen for putative anti-sequestration drugs7.

Selection of Plasmodium falciparum Parasites for Cytoadhesion to Human Brain Endothelial Cells

An in vitro model for cerebral malaria sequestration is described1. Plasmodium falciparum infected red blood cells are selected for binding to immortalized human brain microvascular endothelial cells. The selected parasites show a distinct phenotype. The selection process can be applied using various P. falciparum strains and endothelial cell lines.

Most human malaria deaths are caused by blood-stage Plasmodium falciparum parasites. Cerebral malaria, the most life-threatening complication of the ...

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. 1A-C), females of the genus Leptopilina (Fig. 1D, 1F, 1G) and Ganaspis (Fig. 1E) attack the larval stages. We use these parasites to study the molecular basis of a biological arms race. Parasitic wasps have tremendous value as biocontrol agents. Most of them carry virulence and other factors that modify host physiology and immunity. Analysis of Drosophila wasps is providing insights into how species-specific interactions shape the genetic structures of natural communities. These studies also serve as a model for understanding the hosts' immune physiology and how coordinated immune reactions are thwarted by this class of parasites.
The larval/pupal cuticle serves as the first line of defense. The wasp ovipositor is a sharp needle-like structure that efficiently delivers eggs into the host hemocoel. Oviposition is followed by a wound healing reaction at the cuticle (Fig. 1C, arrowheads). Some wasps can insert two or more eggs into the same host, although the development of only one egg succeeds. Supernumerary eggs or developing larvae are eliminated by a process that is not yet understood. These wasps are therefore referred to as solitary parasitoids.
Depending on the fly strain and the wasp species, the wasp egg has one of two fates. It is either encapsulated, so that its development is blocked (host emerges; Fig. 2 left); or the wasp egg hatches, develops, molts, and grows into an adult (wasp emerges; Fig. 2 right). L. heterotoma is one of the best-studied species of Drosophila parasitic wasps. It is a "generalist," which means that it can utilize most Drosophila species as hosts1. L. heterotoma and L. victoriae are sister species and they produce virus-like particles that actively interfere with the encapsulation response2. Unlike L. heterotoma, L. boulardi is a specialist parasite and the range of Drosophila species it utilizes is relatively limited1. Strains of L. boulardi also produce virus-like particles3 although they differ significantly in their ability to succeed on D. melanogaster1. Some of these L. boulardi strains are difficult to grow on D. melanogaster1 as the fly host frequently succeeds in encapsulating their eggs. Thus, it is important to have the knowledge of both partners in specific experimental protocols.
In addition to barrier tissues (cuticle, gut and trachea), Drosophila larvae have systemic cellular and humoral immune responses that arise from functions of blood cells and the fat body, respectively. Oviposition by L. boulardi activates both immune arms1,4. Blood cells are found in circulation, in sessile populations under the segmented cuticle, and in the lymph gland. The lymph gland is a small hematopoietic organ on the dorsal side of the larva. Clusters of hematopoietic cells, called lobes, are arranged segmentally in pairs along the dorsal vessel that runs along the anterior-posterior axis of the animal (Fig. 3A). The fat body is a large multifunctional organ (Fig. 3B). It secretes antimicrobial peptides in response to microbial and metazoan infections.
Wasp infection activates immune signaling (Fig. 4)4. At the cellular level, it triggers division and differentiation of blood cells. In self defense, aggregates and capsules develop in the hemocoel of infected animals (Fig. 5)5,6. Activated blood cells migrate toward the wasp egg (or wasp larva) and begin to form a capsule around it (Fig. 5A-F). Some blood cells aggregate to form nodules (Fig. 5G-H). Careful analysis reveals that wasp infection induces the anterior-most lymph gland lobes to disperse at their peripheries (Fig. 6C, D).
We present representative data with Toll signal transduction pathway components Dorsal and Sp&auml;tzle (Figs. 4,5,7), and its target Drosomycin (Fig. 6), to illustrate how specific changes in the lymph gland and hemocoel can be studied after wasp infection. The dissection protocols described here also yield the wasp eggs (or developing stages of wasps) from the host hemolymph (Fig. 8).

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Parasitoid (parasitic) wasps constitute a major class of natural enemies of many insects including Drosophila melanogaster. We will introduce the techniques to propagate these parasites in Drosophila spp. and demonstrate how to analyze their effects on immune tissues of Drosophila larvae.

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Plasmodium falciparum, the causative agent of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important health problems worldwide, being responsible for a total of 4 million deaths annually1. Due to their extensive overlap in developing regions, especially Sub-Saharan Africa, co-infections with malaria and HIV-1 are common, but the interplay between the two diseases is poorly understood. Epidemiological reports have suggested that malarial infection transiently enhances HIV-1 replication and increases HIV-1 viral load in co-infected individuals2,3. Because this viremia stays high for several weeks after treatment with antimalarials, this phenomenon could have an impact on disease progression and transmission.
The cellular immunological mechanisms behind these observations have been studied only scarcely. The few in vitro studies investigating the impact of malaria on HIV-1 have demonstrated that exposure to soluble malarial antigens can increase HIV-1 infection and reactivation in immune cells. However, these studies used whole cell extracts of P. falciparum schizont stage parasites and peripheral blood mononuclear cells (PBMC), making it hard to decipher which malarial component(s) was responsible for the observed effects and what the target host cells were4,5. Recent work has demonstrated that exposure of immature monocyte-derived dendritic cells to the malarial pigment hemozoin increased their ability to transfer HIV-1 to CD4+ T cells6,7, but that it decreased HIV-1 infection of macrophages8. To shed light on this complex process, a systematic analysis of the interactions between the malaria parasite and HIV-1 in different relevant human primary cell populations is critically needed.
Several techniques for investigating the impact of HIV-1 on the phagocytosis of micro-organisms and the effect of such pathogens on HIV-1 replication have been described. We here present a method to investigate the effects of P. falciparum-infected erythrocytes on the replication of HIV-1 in human primary monocyte-derived macrophages. The impact of parasite exposure on HIV-1 transcriptional/translational events is monitored by using single cycle pseudotyped viruses in which a luciferase reporter gene has replaced the Env gene while the effect on the quantity of virus released by the infected macrophages is determined by measuring the HIV-1 capsid protein p24 by ELISA in cell supernatants.

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

We have developed an in vitro malaria-HIV-1 co-infection model to study the impact of Plasmodium falciparum on the HIV-1 replicative cycle in human primary monocyte-derived macrophages. This versatile system can easily be adapted to other primary cell types susceptible to HIV-1 infection.

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully understood and several hypotheses have been put forward, including mechanical obstruction of microvessels by P. falciparum-parasitized red blood cells (pRBC). Indeed, during the intra-erythrocytic stage of its life cycle, P. falciparum has the unique ability to modify the surface of the infected erythrocyte by exporting surface antigens with varying adhesive properties onto the RBC membrane. This allows the sequestration of pRBC in multiple tissues and organs by adhesion to endothelial cells lining the microvasculature of post-capillary venules 1. By doing so, the mature forms of the parasite avoid splenic clearance of the deformed infected erythrocytes 2 and restrict their environment to a more favorable low oxygen pressure 3. As a consequence of this sequestration, it is only immature asexual parasites and gametocytes that can be detected in peripheral blood.
Cytoadherence and sequestration of mature pRBC to the numerous host receptors expressed on microvascular beds occurs in severe and uncomplicated disease. However, several lines of evidence suggest that only specific adhesive phenotypes are likely to be associated with severe pathological outcomes of malaria. One example of such specific host-parasite interactions has been demonstrated in vitro, where the ability of intercellular adhesion molecule-1 to support binding of pRBC with particular adhesive properties has been linked to development of cerebral malaria 4,5. The placenta has also been recognized as a site of preferential pRBC accumulation in malaria-infected pregnant women, with chondrotin sulphate A expressed on syncytiotrophoblasts that line the placental intervillous space as the main receptor 6. Rosetting of pRBC to uninfected erythrocytes via the complement receptor 1 (CD35)7,8 has also been associated with severe disease 9.
One of the most recently described P. falciparum cytoadherence phenotypes is the ability of the pRBC to form platelet-mediated clumps in vitro. The formation of such pRBC clumps requires CD36, a glycoprotein expressed on the surface of platelets. Another human receptor, gC1qR/HABP1/p32, expressed on diverse cell types including endothelial cells and platelets, has also been shown to facilitate pRBC adhesion on platelets to form clumps 10. Whether clumping occurs in vivo remains unclear, but it may account for the significant accumulation of platelets described in brain microvasculature of Malawian children who died from CM 11. In addition, the ability of clinical isolate cultures to clump in vitro was directly linked to the severity of disease in Malawian 12 and Mozambican patients 13, (although not in Malian 14).
With several aspects of the pRBC clumping phenotype poorly characterized, current studies on this subject have not followed a standardized procedure. This is an important issue because of the known high variability inherent in the assay 15. Here, we present a method for in vitro platelet-mediated clumping of P. falciparum with hopes that it will provide a platform for a consistent method for other groups and raise awareness of the limitations in investigating this phenotype in future studies. Being based in Malawi, we provide a protocol specifically designed for a limited resource setting, with the advantage that freshly collected clinical isolates can be examined for phenotype without need for cryopreservation.

A Simple Protocol for Platelet-mediated Clumping of Plasmodium falciparum-infected Erythrocytes in a Resource Poor Setting

This method investigates the platelet-mediated clumping phenotype of Plasmodium falciparum-infected erythrocytes (pRBC) in clinical isolates. This is performed by isolating and co-incubating platelet-rich plasma and a suspension of pRBC.

P. falciparum causes the majority of severe malarial infections. The pathophysiological mechanisms underlying cerebral malaria (CM) are not fully ...

Isolation and Analysis of Brain-sequestered Leukocytes from Plasmodium berghei ANKA-infected Mice

We describe a method for isolation and characterization of adherent inflammatory cells from brain blood vessels of P. berghei ANKA-infected mice. Infection of susceptible mouse-strains with this parasite strain results in the induction of experimental cerebral malaria, a neurologic syndrome that recapitulates certain important aspects of Plasmodium falciparum-mediated severe malaria in humans 1,2 . Mature forms of blood-stage malaria express parasitic proteins on the surface of the infected erythrocyte, which allows them to bind to vascular endothelial cells. This process induces obstructions in blood flow, resulting in hypoxia and haemorrhages 3 and also stimulates the recruitment of inflammatory leukocytes to the site of parasite sequestration.
Unlike other infections, i.e neutrotopic viruses4-6, both malaria-parasitized red blood cells (pRBC) as well as associated inflammatory leukocytes remain sequestered within blood vessels rather than infiltrating the brain parenchyma. Thus to avoid contamination of sequestered leukocytes with non-inflammatory circulating cells, extensive intracardial perfusion of infected-mice prior to organ extraction and tissue processing is required in this procedure to remove the blood compartment. After perfusion, brains are harvested and dissected in small pieces. The tissue structure is further disrupted by enzymatic treatment with Collagenase D and DNAse I. The resulting brain homogenate is then centrifuged on a Percoll gradient that allows separation of brain-sequestered leukocytes (BSL) from myelin and other tissue debris. Isolated cells are then washed, counted using a hemocytometer and stained with fluorescent antibodies for subsequent analysis by flow cytometry.
This procedure allows comprehensive phenotypic characterization of inflammatory leukocytes migrating to the brain in response to various stimuli, including stroke as well as viral or parasitic infections. The method also provides a useful tool for assessment of novel anti-inflammatory treatments in pre-clinical animal models.

Isolation and Analysis of Brain-sequestered Leukocytes from Plasmodium berghei ANKA-infected Mice

A method for isolation of adherent inflammatory leukocytes from brain blood vessels of Plasmodium berghei ANKA-infected mice is described. The method allows quantification as well as phenotypic characterization of isolated leukocytes after staining with fluorescent antibodies and subsequent analysis by flow cytometry.

We describe a method for isolation and  characterization of adherent inflammatory cells from brain blood vessels of P. berghei ANKA-infected mice. ...

Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the &asymp;40% limit, the investigator usually keeps the percentage at around 10%. In many cases it is necessary to isolate the parasite-containing red blood cells (RBCs) from the uninfected ones, to enrich the culture and proceed with a given experiment. 
When P. falciparum infects the erythrocyte, the parasite degrades and feeds from haemoglobin 2, 3. However, the parasite must deal with a very toxic iron-containing haem moiety 4, 5. The parasite eludes its toxicity by transforming the haem into an inert crystal polymer called haemozoin 6, 7. This iron-containing molecule is stored in its food vacuole and the metal in it has an oxidative state which differs from the one in haem 8. The ferric state of iron in the haemozoin confers on it a paramagnetic property absent in uninfected erythrocytes. As the invading parasite reaches maturity, the content of haemozoin also increases 9, which bestows even more paramagnetism on the latest stages of P. falciparum inside the erythrocyte.
Based on this paramagnetic property, the latest stages of P. falciparum infected-red blood cells can be separated by passing the culture through a column containing magnetic beads. These beads become magnetic when the columns containing them are placed on a magnet holder. Infected RBCs, due to their paramagnetism, will then be trapped inside the column, while the flow-through will contain, for the most part, uninfected erythrocytes and those containing early stages of the parasite.
Here, we describe the methodology to enrich the population of late stage parasites with magnetic columns, which maintains good parasite viability 10. After performing this procedure, the unattached culture can be returned to an incubator to allow the remaining parasites to continue growing.

Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

The paramagnetic properties of hemozoin are used to isolate late stages of Plasmodium falciparum-infected red blood cells growing in culture. The method is simple and fast and does not affect the subsequent invasive capabilities of the parasites.

Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the ...

High Yield Purification of Plasmodium falciparum Merozoites For Use in Opsonizing Antibody Assays

Plasmodium falciparum merozoite antigens are under development as potential malaria vaccines. One aspect of immunity against malaria is the removal of free merozoites from the blood by phagocytic cells. However assessing the functional efficacy of merozoite specific opsonizing antibodies is challenging due to the short half-life of merozoites and the variability of primary phagocytic cells. Described in detail herein is a method for generating viable merozoites using the E64 protease inhibitor, and an assay of merozoite opsonin-dependent phagocytosis using the pro-monocytic cell line THP-1. E64 prevents schizont rupture while allowing the development of merozoites which are released by filtration of treated schizonts. &#160;Ethidium bromide labelled merozoites are opsonized with human plasma samples and added to THP-1 cells. Phagocytosis is assessed by a standardized high throughput protocol. Viable merozoites are a valuable resource for assessing numerous aspects of P. falciparum biology, including assessment of immune function. Antibody levels measured by this assay are associated with clinical immunity to malaria in naturally exposed individuals. The assay may also be of use for assessing vaccine induced antibodies. &#160;

High Yield Purification of Plasmodium falciparum Merozoites For Use in Opsonizing Antibody Assays

Measuring antibody function is key to understanding immunity to Plasmodium falciparum malaria. This method describes the purification of viable merozoites, and measurement of opsonization-dependent phagocytosis by flow cytometry.

Plasmodium falciparum merozoite antigens are under development as potential malaria vaccines. One aspect of immunity against malaria is the removal of ...

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR (RS-PCR)

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, therefore, suitable to be used for routine purposes. For best resolution, data evaluation and data management, a miniaturized electrophoresis system is required. Together with such an electrophoresis system and the in-house developed software (freely available here) assignment of the pattern of bands to a genotype is standardized and straight forward. DNA extraction is simple (boiling prep), setting-up of the reactions is easy and they can be run on any standard PCR machine. PCR cycling is common except prolonged ramping and elongation times. Compared to spa typing and Multi Locus Sequence Typing (MLST), RS-PCR does not require DNA sequencing what simplifies the analysis considerably and allows a high throughput. Furthermore, the resolution for bovine strains of S. aureus is at least as good as spa typing and better than MLST or pulsed-field gel electrophoresis (PFGE). The RS-PCR data base includes presently a total of 141 genotypes and variants. The method is highly associated with the virulence gene pattern, contagiosity and pathogenicity of S. aureus strains involved in bovine mastitis. S. aureus genotype B (GTB) is contagious and causes herds problems causing large costs in the Switzerland and other European countries. All the other genotypes observed in Switzerland infect individual cows and quarters. Genotyping by RS-PCR allows the reliable prediction of the epidemiological and the pathogenic potential of S. aureus involved in bovine intramammary infection (IMI), two key factors for clinical veterinary medicine. Because of these beneficial properties together with moderate costs and a high sample throughput the goal of this publication is to give a detailed, step-by-step protocol for easily establishing and running RS-PCR for genotyping S. aureus in other laboratories.

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR RS-PCR

Here, ribosomal spacer PCR (RS-PCR) is used together with a miniaturized electrophoresis system as a fast and high resolution method for genotyping S. aureus at moderate costs allowing a high throughput.

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, ...

Development of Stem Cell-derived Antigen-specific Regulatory T Cells Against Autoimmunity

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic self-tolerance. Tregs represent about 5 - 10% of the mature CD4+ T cell subpopulation in mice and humans, with about 1 - 2% of those Tregs circulating in the peripheral blood. Induced pluripotent stem cells (iPSCs) can be differentiated into functional Tregs, which have a potential to be used for cell-based therapies of autoimmune diseases. Here, we present a method to develop antigen (Ag)-specific Tregs from iPSCs (i.e., iPSC-Tregs). The method is based on incorporating the transcription factor FoxP3 and an Ag-specific T cell receptor (TCR) into iPSCs and then differentiating on OP9 stromal cells expressing Notch ligands delta-like (DL) 1 and DL4. Following in vitro differentiation, the iPSC-Tregs express CD4, CD8, CD3, CD25, FoxP3, and Ag-specific TCR and are able to respond to Ag stimulation. This method has been successfully applied to cell-based therapy of autoimmune arthritis in a murine model. Adoptive transfer of these Ag-specific iPSC-Tregs into Ag-induced arthritis (AIA)-bearing mice has the ability to reduce joint inflammation and swelling and to prevent bone loss.

We present here a method to develop functional antigen (Ag)-specific regulatory T cells (Tregs) from induced pluripotent stem cells (iPSCs) for immunotherapy of autoimmune arthritis in a murine model.

Autoimmune diseases arise due to the loss of immunological self-tolerance. Regulatory T cells (Tregs) are important mediators of immunologic ...

Using Phylogenetic Analysis to Investigate Eukaryotic Gene Origin

Phylogenetic analysis uses nucleotide or amino acid sequences or other parameters, such as domain sequences and three-dimensional structure, to construct a tree to show the evolutionary relationship among different taxa (classification units) at the molecular level. Phylogenetic analysis can also be used to investigate domain relationships within an individual taxon, particularly for organisms that have undergone substantial change in morphology and physiology, but for which researchers lack fossil evidence due to the organisms&#39; long evolutionary history or scarcity of fossilization.
In this text, a detailed protocol is described for using the phylogenetic method, including amino acid sequence alignment using Clustal Omega, and subsequent phylogenetic tree construction using both Maximum Likelihood (ML) of Molecular Evolutionary Genetics Analysis (MEGA) and Bayesian Inference via MrBayes. To investigate the origin of eukaryotic Sugars Will Eventually be Exported Transporters (SWEET) genes, 228 SWEETs including 35 SWEET proteins from unicellular eukaryotes and 57 SemiSWEET proteins from prokaryotes were analyzed. Interestingly, SemiSWEETs were found in prokaryotes, but SWEETs were found in eukaryotes. Two phylogenetic trees constructed using theoretically distinct methods have consistently&#160;suggested that the first eukaryotic SWEET gene might stem from the fusion of a bacterial SemiSWEET gene and an archaeal SemiSWEET gene.&#160;It is worth noting that one should be cautious to draw a conclusion based only on phylogenetic analysis, although it is useful to explain the underlying relationship between different taxa, which is difficult or even impossible to discern through experimental means.

A method of constructing a phylogenetic tree based on sequence homology of SWEETs from eukaryotes and SemiSWEETs from prokaryotes is described. Phylogenetic analysis is a useful tool for explaining the evolutionary relatedness between homologous proteins or genes from different organism groups.

Phylogenetic analysis uses nucleotide or amino acid sequences or other parameters, such as domain sequences and three-dimensional structure, to construct ...