The technical assistance and instrumentation of the University of Maryland Greenebaum Cancer Center Translational Core Facility, especially Drs. Rena Lapidus and Mariola Sadowska, are gratefully acknowledged. The work responsible for the development of this assay was funded in part by NIH RO1CA108846, AHA Grant-in-Aid GRNT2130014, a VA Merit Award to A.P., and by the University of Maryland Cigarette Restitution Funds (CRF) provided to the Marlene &amp; Stewart Greenebaum Cancer Center.

Several steps are performed ahead of time and several reagents are prepared and stored prior to the procedure: (1) cell culture and protein isolation, (2) preparation of oligonucleotide, (3) preparation of 96-well plates, (4) nuclear extract incubation overnight. Procedure requires 2 days because of the overnight incubation of nuclear protein with DNA oligonucleotides.
1. Preparation of Buffers
1.1 Nuclear protein isolation
<ol>
	<li>Hypotonic Buffer: To prepare 100 ml of hypotonic buffer, add 1 ml (1 M HEPES, pH 7.9), 150 &mu;l (1 M MgCl2), 333 &mu;l (3 M KCl) to 98.3 ml H2O. Final Concentrations: 10 mM HEPES, 1.5 mM MgCl2, 10 mM KCl. For Hypotonic buffer + NP40 (for use in step 2.11): Add 0.5 ml (10% NP40) to 9.5 ml Hypotonic buffer for final 0.5% NP40.</li>
	<li>Low Salt Buffer: To prepare 100 ml of low salt buffer (for use in step 2.15), add 1 ml (1 M HEPES, pH 7.9), 25 ml Glycerol, 150 &mu;l (1 M MgCl2), 666 &mu;l (3 M KCl), 40 &mu;l (0.5 M EDTA) to 73 ml H2O. Final concentrations: 10 mM HEPES, 25% Glycerol, 1.5 mM MgCl2, 20 mM KCl, 0.2 mM EDTA.</li>
	<li>High Salt Buffer: To prepare 100 ml of high salt buffer (for use in step 2.15), add 1 ml (1 M HEPES, pH 7.9), 25 ml Glycerol, 150 &mu;l (1 M MgCl2), 26.7 ml (3 M KCl), 40 &mu;l (0.5M EDTA) to 47 ml H2O. Final concentrations: 10 mM HEPES, 25% Glycerol, 1.5 mM MgCl2, 800 mM KCl, 0.2 mM EDTA.</li>
	<li>10% NP40 Detergent: 10 ml NP40 to 90 ml H2O</li>
	<li>Protease and phosphatase inhibitors [added to hypotonic buffer + NP40 (step 2.11), to low salt buffer (step 2.15), and to high salt buffer (step 2.15) just prior to use]: Add 2.5 &mu;l (1 M DTT) and 50 &mu;l of protease inhibitors (100x) to 5 ml of each buffer for final concentration of 0.5 mM DTT and 1x protease inhibitors. The protease inhibitor 100x stock mixture includes: sodium fluoride (Ser/Thr, acidic phosphatases), sodium orthovanadate (Tyr, alkaline phosphatases), &#946;-glycerophosphate (Ser/Thr phosphatases), sodium pyrophosphate (Ser/Thr phosphatases), Aprotinin (Ser proteases), Bestatin (amino-peptidases), E64 (Cysteine proteases), Leupeptin (Ser/Cys proteases), EDTA (metalloproteases).</li>
</ol>
1.2 Preparation of assay plates
<ol>
	<li>Plate fixing solution: To prepare 500 ml of solution, add 5.25 g sodium carbonate to 500 ml H2O, mix well and adjust pH to 9.7 for a final concentration of 0.1 M sodium carbonate.</li>
	<li>Plate blocking solution: To prepare stock poly dI/dC oligonucleotide, resuspend 1 Unit (~50 mg) of poly dI/dC in 1 ml of 10 mM Tris/HCl, pH 7.9 containing 1 mM EDTA for a stock concentration of 50 &mu;g/&mu;l. Stock is diluted to 1 &mu;g/&mu;l prior to use.</li>
</ol>
1.3 Wash buffers and antibody dilutions
NOTE: Streptavidin wash buffer is used to wash plates in between additions and to dilute primary and secondary antibodies.
<ol>
	<li>To prepare 1 L of Streptavidin wash buffer, add 2.4 g Tris/HCl, 37.5 ml (4 M NaCl), 10 ml (10% BSA), 5 ml (10% Tween-20), to 1 L Millipore-sterile filtered water, pH 7.18. Store at 4 &deg;C. Final concentrations: 20 mM Tris/HCl, 150 mM NaCl, 0.1% BSA, 0.05% Tween-20.</li>
</ol>
1.4 DNA-binding buffer
NOTE: This buffer is stored at -20 &deg;C.
<ol>
	<li>To prepare 15 ml of DNA binding buffer, add 180 &mu;l (1 M HEPES, pH 7.9), 300 &mu;l (3 M KCl), 12 &mu;l (0.5 M EDTA, pH 8.0), 7.5 &mu;l (1 M DTT), 3.0 ml (60% glycerol), 300 &mu;l (50 &mu;g/&mu;l poly dI/dC) diluted with deionized/distilled H2O (12 ml). Final concentrations: 12 mM HEPES/pH 7.9, 60 mM KCl, 0.4 mM EDTA, 0.5 mM DTT, 12% glycerol, 1 &mu;g/&mu;l poly dI/dC.</li>
</ol>
2. Cell Culture and Nuclear Protein Isolation
NOTE: The preparation requires about 3 hr. Stimulation of cells will depend on experiment. The number of cells used for each experiment will vary and all volumes reflect a typical experiment using 3 x 107 cells/point. Adjust volumes to accommodate the cell number actually used in the experiment 6.
<ol>
	<li>To prepare nuclear protein for DNA binding assays, culture human cells that express RUNX2 (endothelial, osteosarcoma, breast cancer cells) in appropriate media 6.</li>
	<li>Treat subconfluent cells with nocodazole (0.2 &mu;g/ml for 16 hr) to arrest cells at the G2/M cell cycle boundary 6. Under these conditions, the RUNX2 protein is stabilized and maximal DNA binding is achieved. In this way, enough nuclear protein is available for multiple assays and inhibitors can be compared from the same preparation.</li>
	<li>For each step, pre-cool the centrifuge to 4 &deg;C and prepare buffers and chill 20 min at 4 &deg;C before cell harvest.</li>
	<li>Chill cells (4 &deg;C) and conduct procedures on ice.</li>
	<li>Centrifuge cells at 1,000 rpm for 5 min in a 15 ml polypropylene round-bottom tube.</li>
	<li>Wash 1x with ice-cold PBS (Ca2+ and Mg2+ free).</li>
	<li>Centrifuge again and discard PBS supernatant.</li>
	<li>Add 500 &mu;l of hypotonic buffer without protease inhibitors, being careful to completely resuspend the cell pellet.</li>
	<li>Transfer contents to a 1.5 ml Eppendorf tube.</li>
	<li>Immediately centrifuge at 5,500 rpm for 5.5 min; discard the supernatant and KEEP the cell pellet.</li>
	<li>Resuspend the cell pellet in 500 &mu;l of hypotonic buffer containing 0.5% NP40. Add protease and phosphatase inhibitors and 0.5 mM DTT (as described in step 1.1.5).</li>
	<li>Allow the sample to rest on ice for 30 min.</li>
	<li>Centrifuge at 13,000 rpm for 10 min.</li>
	<li>Discard the supernatant (contains the cytosolic proteins).</li>
	<li>Resuspend the nuclear pellet in 60 &mu;l each of low salt buffer (to which protease inhibitors and 0.5 mM DTT have been added from step 1.1.5) and high salt buffer (to which protease inhibitors and 0.5 mM DTT have been added from step 1.1.5) for a total of 120 &mu;l. Add 60 &mu;l of low salt buffer to the pellet first and resuspend, then add 60 &mu;l of high salt buffer. Vortex the pellet to aid in resuspension.</li>
</ol>
NOTE: This step helps get rid of some of the nuclear membrane proteins and set up for the lysis step: low salt first (resuspend pellet, vortex), then high salt (vortex) optimizes this step. Keep extract on ice for 30 min, with vortexing after the first 10 min.
<ol start="16">
	<li>Centrifuge at 12,000 rpm for 15 min; keep the supernatant containing the nuclear protein.</li>
	<li>Measure protein concentration (try to keep samples at 2-5 mg/ml), aliquot in appropriate amounts (10 &mu;l/tube) and store at -80 &deg;C.</li>
</ol>
NOTE: Estimated yield: 30 x 106 cells will yield 5 &mu;g/&mu;l protein in 120 &mu;l. 5 x 106 cells will yield 2.2 &mu;g/&mu;l protein in 40 &mu;l.
3. Preparation of Double Stranded Oligonucleotide
<ol>
	<li>Design complementary oligonucleotides with compatible half sites on the ends. For RUNX2 these are: 5'-CGTATTAACCACAATACTCGCGTATTAACCACAATACTCGCGTATTAACCACAATAC TCG -3'-Biotin (sense) and 5'CGAGTATTGTGGTTAATACGCGAGTATTGTGGTTAATACGCGAGTATT GTGGTTAATACG -3'-Biotin (antisense).</li>
</ol>
NOTE: Pilot experiments determined that three RUNX2 binding sites and single-end labeled biotin yielded the most reproducible results.
<ol start="2">
	<li>Prepare 5x annealing buffer: Add 300 &mu;l (1 M Tris-HCl, pH 7.6), 30 &mu;l (1 M MgCl2), 10 &mu;l (1 M DTT) to 260 &mu;l H2O (final 600 &mu;l).</li>
	<li>To 200 pmol of each single-stranded oligonucleotide (3 &mu;l), add 12 &mu;l of 5x annealing buffer and 45 &mu;l H2O for a total of 60 &mu;l (200 pmol/60 &mu;l).</li>
	<li>Heat at 95 &deg;C for 5-10 min in a heating block.</li>
	<li>Cool to 65 &deg;C slowly (by setting the temperature to 65 &deg;C, it takes 15 min), then cool to room temperature slowly by turning off the power of the heating block (or by placing in 50 ml of the 65 &deg;C water in a beaker on ice; this takes 15-20 min).</li>
</ol>
4. Preparation of 96-well Plates
NOTE: Do not use milk proteins in the wash buffers.
<ol>
	<li>Fix plate with fixing solution (0.1 M sodium carbonate): add 300 &mu;l/well.</li>
	<li>Incubate for 2 hr by rocking at room temperature (RT), or no rocking at 4 &deg;C (O/N).</li>
	<li>Wash plate 3x with streptavidin wash buffer (WB): add 300 &mu;l/well each time.</li>
	<li>Add biotin-labeled double-stranded oligonucleotide (3 consensus binding sites per nucleotide) for 2 hr with rocking (1.25 nmol/well; 100 &mu;l/well).</li>
	<li>Wash 3x with cold WB: add 300 &mu;l/well and then immediately invert the plate into a sink and blot the edges on a paper towel after each addition.</li>
</ol>
NOTE: Do not use pipette tips to remove fluid from the plates as this may scrape avidin:biotin:DNA complexes from the wells. Do this for all subsequent wash steps.
5. Incubation with Nuclear Extract
NOTE: Do not substitute salmon or herring sperm DNA for the poly dI/dC blocking buffer. Avoid blocking plates with milk proteins. Both of these blocking agents result in high background values.
<ol>
	<li>Incubate with specific transcription factor prepared from nuclear extract (90 &mu;l/well). Prepare a master mix containing nuclear extract (DNA binding protein; 3-9 &mu;g/well) + poly dI/dC (1 &mu;g/&mu;l from a 50 &mu;g/ul stock) in 1x DNA binding buffer. Volume is as needed for the total number of wells required (90 &mu;l/well).</li>
	<li>Any potential inhibitor, such as vitamin D3 (Figure 2) or CADD compound 5221975 (Figure 3), or the appropriate dilution of the solvent control, such as ethanol, is added at this step.</li>
	<li>Place plate on rocking platform, O/N at 4 &deg;C.</li>
	<li>Wash 3x with WB: add 300 &mu;l/well</li>
</ol>
6. Addition of Primary Antibody
NOTE: Primary antibody dilutions should be prepared fresh - storage is not recommended.
<ol>
	<li>Dilute RUNX2-specific monoclonal antibody (stock 1 &mu;g/&mu;l) 1/5,000 in Streptavidin wash buffer. Prepare enough for addition to each well of the 96-well plate (90 &mu;l/well) in triplicate.</li>
	<li>Incubate for 1 hr at RT on a rocking platform.</li>
	<li>Wash 3x with WB; add 300 &mu;l/well.</li>
</ol>
7. Addition of Secondary Antibody
NOTE: Secondary antibody dilutions can be stored at 4 &deg;C overnight if needed the next day.
<ol>
	<li>Dilute Fab-specific affinity purified-HRP conjugated antibody (7.1 mg/ml stock) to 1:1,400 in Streptavidin wash buffer: 3.5 &mu;l antibody/5.0 ml wash buffer. Prepare enough for addition to each well of the 96-well plate (90 &mu;l/well) in triplicate.</li>
	<li>Incubate for 30 min at RT on a rocking platform.</li>
	<li>Wash 6x with WB by inverting plate into sink (300 &mu;l/well).</li>
</ol>
8. HRP Substrate and Product Development
<ol>
	<li>Add 50 &mu;l of TMB substrate per well directly from stock bottle.</li>
	<li>Incubate 10-20 min at RT in the dark (stop reaction method) or measure absorbance directly (continuous kinetic monitoring).</li>
</ol>
9. Reaction Measurement
<ol>
	<li>Stop reaction method: For visual stop reaction, check for color change from clear to blue and stop reaction with 50 &mu;l sulfuric acid.</li>
	<li>Measure absorbance at 450 nm with the Biotrak II Visible plate reader Spectrophotometer (Amersham Biosciences; GE Healthcare Biosciences Corp. Piscataway NJ, USA) or a similar instrument.</li>
	<li>Continuous kinetic monitoring method: Add substrate after the last wash and just prior to placing in the spectrophotometer (do not stop the reaction).</li>
	<li>Measure absorbance at 635 nm with the Bio-Tek Synergy HT Multi-reaction microplate reader Spectrophotometer (Bio-Tek Instruments, Inc; Winooski, VT, USA) or a similar instrument.</li>
</ol>

<ol>
	<li>Hellman, L. M., Fried, M. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+mobility+shift+assay+(EMSA)+for+detecting+protein-nucleic+acid+interactions.">Electrophoretic mobility shift assay (EMSA) for detecting protein-nucleic acid interactions.</a> Nat. Protoc. 2, 1849-1861 (2007).</li><li>Bhattacharya, N., Sarno, A., Idler, I. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+detection+of+nuclear+factor-kappaB+activity+using+a+sensitive+oligo-based+chemiluminescent+enzyme-linked+immunosorbent+assay.">High-throughput detection of nuclear factor-kappaB activity using a sensitive oligo-based chemiluminescent enzyme-linked immunosorbent assay.</a> Int. J. Cancer. 127, 404-411 (2010).</li><li>Hartzell, D. D., Trinklein, N. D., Mendez, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+functional+analysis+of+the+CREB+signaling+pathway+using+HaloCHIP-chip+and+high+throughput+reporter+assays.">A functional analysis of the CREB signaling pathway using HaloCHIP-chip and high throughput reporter assays.</a> BMC Genomics. 10, 497 (2009).</li><li>Vuori, K. A., Ahlskog, J. K., Sistonen, L., Nikinmaa, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TransLISA,+a+novel+quantitative,+nonradioactive+assay+for+transcription+factor+DNA-binding+analyses.">TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses.</a> FEBS J. 276, 7366-7374 (2009).</li><li>D'Souza, D. R., Salib, M. M., Bennett, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hyperglycemia+Regulates+RUNX2+Activation+and+Cellular+Wound+Healing+through+the+Aldose+Reductase+Polyol+Pathway.">Hyperglycemia Regulates RUNX2 Activation and Cellular Wound Healing through the Aldose Reductase Polyol Pathway.</a> J. Biol. Chem. 284, 17947-17955 (2009).</li><li>Underwood, K. F., D'Souza, D. R., Mochin, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+RUNX2+transcription+factor-DNA+interactions+and+cell+proliferation+by+Vitamin+D3+(cholecalciferol)+prohormone+activity.">Regulation of RUNX2 transcription factor-DNA interactions and cell proliferation by Vitamin D3 (cholecalciferol) prohormone activity.</a> J. Bone Miner Res. 27, 913-925 (2012).</li><li>Held, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetic+analysis+of+ß-galactosidase+activity+using+the+PowerWave+HT+and+Gen5+data+analysis+software:+basic+enzyme+kinetic+determinations.">Kinetic analysis of ß-galactosidase activity using the PowerWave HT and Gen5 data analysis software: basic enzyme kinetic determinations.</a> Biotek Instruments Application Note. , (2007).</li><li>Renard, P., Ernest, I., Houbion, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+sensitive+multi-well+colorimetric+assay+for+active+NFkappaB.">Development of a sensitive multi-well colorimetric assay for active NFkappaB.</a> Nucleic Acids Res. 29, E21 (2001).</li><li>Pommier, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+topoisomerase+I+inhibitors:+chemistry,+biology,+and+interfacial+inhibition.">DNA topoisomerase I inhibitors: chemistry, biology, and interfacial inhibition.</a> Chem Rev. 109, 2894-2902 (2009).</li><li>Pennisi, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomics.+ENCODE+project+writes+eulogy+for+junk+DNA.">Genomics. ENCODE project writes eulogy for junk DNA.</a> Science. 337, 1159-1161 (2012).</li></ol>

We have nothing to disclose.

DNA-binding assays are used to measure the ability of transcription factors to interact with DNA. Assays for DNA binding include electrophoretic mobility shift (EMSA) 1 and chromatin immuneprecipitation (ChIP) based assays 3 as well as assays employing 96-well formats 4 such as chemiluminescent assays 2. The EMSA is non-quantitative and uses radiolabeled (32P) oligonucleotides. These are incubated with nuclear proteins and binding complexes are separated on agarose o...

DNA-binding assays have utility in measuring the ability of transcription factors to interact with DNA. Assays for DNA binding include electrophoretic mobility shift assays (EMSA) that depend on radiolabeled oligonucleotides 1 or chemiluminescence assays 2. Chromatin immuneprecipitation (ChIP) based assays 3 as well as assays employing 96-well formats 4 have also been described. However, the EMSA is a non-quantitative assay that requires the use of radiolabeled oligonucleotides. When nuclear proteins associate with the specific nucleotide promoter sequences, binding complexes are retarded on polyacrylamide gels and the specific transcription factor can be validated with an antibody "supershift". We have developed a quantitative DNA-binding assay using an enzyme-linked immunosorbent format (D-ELISA), which is able to measure the interaction of RUNX2 with DNA-binding sequences corresponding to defined promoter elements in RUNX2 target genes. Use of an anti-RUNX2 antibody provides specificity to the assay and the lack of radiolabel distinguish this assay from the traditional gel shift assay 5. Detection of binding complexes is possible with the use of a secondary antibody coupled to horseradish peroxidase (HRP), which converts an HRP substrate, tetramethyl benzidine (TMB) to a colored product for spectrophotometric analysis. The assay reported here can incorporate the use of mutated DNA oligonucleotides as controls and can be used for detection of competitive or non-competitive inhibitors of DNA binding. The screening of novel anti-tumor compounds is also possible with this assay.

<table border="1">
	<tbody>
		<tr>
			<td>Name of the Reagent</td>
			<td>Company</td>
			<td>Catalogue Number</td>
			<td>Comments (optional)</td>
		</tr>
		<tr>
			<td>Poly dI/dC</td>
			<td>GE Healthcare, Piscataway, NJ</td>
			<td>US20539-5UN</td>
			<td>1 U ~50mg</td>
		</tr>
		<tr>
			<td>RUNX2 antibody</td>
			<td>MBL International Corp., Woburn, MA</td>
			<td>D130-3</td>
			<td>1 mg/ml</td>
		</tr>
		<tr>
			<td>Fab-specific peroxidase conjugated antibody</td>
			<td>Sigma-Aldrich, St. Louis, MO</td>
			<td>A9917</td>
			<td>7.1 mg/ml</td>
		</tr>
		<tr>
			<td>TMB Substrate (tetramethyl benzidine)</td>
			<td>EXALPHA Biologicals, Shirley, MA</td>
			<td>X1189S</td>
			<td>100 ml</td>
		</tr>
		<tr>
			<td>Sodium carbonate</td>
			<td>Sigma-Aldrich, St. Louis, MO</td>
			<td>57995</td>
			<td>Plate-fixing</td>
		</tr>
		<tr>
			<td>Sulfuric Acid</td>
			<td>VWR, West Chester, PA</td>
			<td>BDH-39922-1</td>
			<td>Stop solution</td>
		</tr>
		<tr>
			<td>Multi-well plates</td>
			<td>Greiner Bio-One, Basel, Switzerland</td>
			<td>655996</td>
			<td>Avidin-coated, black sides</td>
		</tr>
		<tr>
			<td>HALT</td>
			<td>Thermo-Scientific/Pierce, Rockford, IL</td>
			<td>78440</td>
			<td>Protease and phosphatase inhibitors</td>
		</tr>
		<tr>
			<td>Chemicals</td>
			<td>Various manufacturers</td>
			<td>Laboratory grade</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>Table 1. Reagents</td>
		</tr>
		<tr>
			<td>Spectrophotometer: Biotrak II Visible plate reader</td>
			<td>Amersham Biosciences</td>
			<td>&nbsp;</td>
			<td>For use with stop reaction method</td>
		</tr>
		<tr>
			<td>Spectrophotometer: Bio-Tek Synergy HT Multi-reaction microplate reader</td>
			<td>Bio-Tek Instruments, Inc.</td>
			<td>&nbsp;</td>
			<td>For use with continuous kinetic monitoring</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>Table 2. Equipment</td>
		</tr>
	</tbody>
</table>

a quantitative assay to study protein:dna interactions, discover transcriptional regulators of gene expression, and identify novel anti-tumor agents

Many DNA-binding assays such as electrophoretic mobility shift assays (EMSA), chemiluminescent assays, chromatin immunoprecipitation (ChIP)-based assays, and multiwell-based assays are used to measure transcription factor activity. However, these assays are nonquantitative, lack specificity, may involve the use of radiolabeled oligonucleotides, and may not be adaptable for the screening of inhibitors of DNA binding. On the other hand, using a quantitative DNA-binding enzyme-linked immunosorbent assay (D-ELISA) assay, we demonstrate nuclear protein interactions with DNA using the RUNX2 transcription factor that depend on specific association with consensus DNA-binding sequences present on biotin-labeled oligonucleotides. Preparation of cells, extraction of nuclear protein, and design of double stranded oligonucleotides are described. Avidin-coated 96-well plates are fixed with alkaline buffer and incubated with nuclear proteins in nucleotide blocking buffer. Following extensive washing of the plates, specific primary antibody and secondary antibody incubations are followed by the addition of horseradish peroxidase substrate and development of the colorimetric reaction. Stop reaction mode or continuous kinetic monitoring were used to quantitatively measure protein interaction with DNA. We discuss appropriate specificity controls, including treatment with non-specific IgG or without protein or primary antibody. Applications of the assay are described including its utility in drug screening and representative positive and negative results are discussed.

The D-ELISA method is highly specific for the designated DNA-binding protein as long as a sequence-specific, double-stranded oligonucleotide containing three copies of the consensus RUNX2 binding site (ACACCA) is used. The primary antibody recognizing the protein factor also enhances the specificity. The secondary antibody contains covalently-linked horseradish peroxidase (HRP) that converts a clear substrate (tetramethyl benzidine) to a colored product for ease of detection (Figure 1). For these reasons...

Watch this Scientific Journal Video about A Quantitative Assay to Study Protein:DNA Interactions, Discover Transcriptional Regulators of Gene Expression, and Identify Novel Anti-tumor Agents at JoVE.c

A Quantitative Assay to Study Protein:DNA Interactions, Discover Transcriptional Regulators of Gene Expression, and Identify Novel Anti-tumor Agents

We developed a quantitative DNA-binding, ELISA-based assay to measure transcription factor interactions with DNA. High specificity for the RUNX2 protein was achieved with a consensus DNA-recognition oligonucleotide and specific monoclonal antibody. Colorimetric detection with an enzyme-coupled antibody substrate reaction was monitored in real time.

Many DNA-binding assays such as electrophoretic mobility shift assays (EMSA), chemiluminescent assays, chromatin immunoprecipitation (ChIP)-based assays, ...

a-quantitative-assay-to-study-proteindna-interactions-discover

Research

JoVE Journal

Biology

18.5K Aufrufe.  University of Maryland School of Medicine.  Wir entwickelten eine quantitative DNA-bindenden, ELISA-basierten Assay Transkriptionsfaktor-Interaktionen mit DNA zu messen. Hohe Spezifität für das RUNX2 Protein wurde mit einer Consensus-DNA-Oligonukleotid und Erkennung spezifischer monoklonaler Antikörper erreicht. Kolorimetrischen Nachweis mit einem Enzym-gekoppelten Antikörper Substrat-Reaktion wurde in Echtzeit überwacht. 

Serie: A Quantitative Assay to Study Protein:DNA Interactions, Discover Transcriptional Regulators of Gene Expression, and Identify Novel Anti-tumor Agents

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell  electroporation system and Gene Pulser  electroporation buffer were specifically developed to transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells.This video demonstrates how to establish primary hematopoietic cell cultures from murine bone marrow, and then prepare them for electroporation in the MXcell system. We begin by isolating femur and tibia. Bone marrow from both femur and tibia are then harvested and cultures are established. Cultured bone marrow cells are then transfected and analyzed.

This procedure describes how to establish primary hematopoietic cell cultures from murine bone marrow and is followed by transfection using the Gene Pulser MXCell electroporation system.

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser ...

Using the Gene Pulser MXcell Electroporation System to Transfect Primary Cells with High Efficiency

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell electroporation system and Gene Pulser electroporation buffer (Bio-Rad) were specifically developed to easily transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells. We will demonstrate how to perform a simple experiment to quickly identify the best electroporation conditions. We will demonstrate how to run several samples through a range of electroporation conditions so that an experiment can be conducted at the same time as optimization is performed. We will also show how optimal conditions identified using 96-well electroporation plates can be used with standard electroporation cuvettes, facilitating the switch from electroporation plates to electroporation cuvettes while maintaining the same electroporation efficiency. In the video, we will also discuss some of the key factors that can lead to the success or failure of electroporation experiments.

This procedure shows how to use the Gene Pulser MXcell electroporation system to rapidly and easily identify the best electroporation conditions for mouse embryonic fibroblasts (MEFs) or other primary cells. Considerations for troubleshooting are also discussed in the associated video.

Hi-C: A Method to Study the Three-dimensional Architecture of Genomes.

The three-dimensional folding of chromosomes compartmentalizes the genome and and can bring distant functional elements, such as promoters and enhancers, into close spatial proximity 2-6. Deciphering the relationship between chromosome organization and genome activity will aid in understanding genomic processes, like transcription and replication. However, little is known about how chromosomes fold. Microscopy is unable to distinguish large numbers of loci simultaneously or at high resolution. To date, the detection of chromosomal interactions using chromosome conformation capture (3C) and its subsequent adaptations required the choice of a set of target loci, making genome-wide studies impossible 7-10.
We developed Hi-C, an extension of 3C that is capable of identifying long range interactions in an unbiased, genome-wide fashion. In Hi-C, cells are fixed with formaldehyde, causing interacting loci to be bound to one another by means of covalent DNA-protein cross-links. When the DNA is subsequently fragmented with a restriction enzyme, these loci remain linked. A biotinylated residue is incorporated as the 5' overhangs are filled in. Next, blunt-end ligation is performed under dilute conditions that favor ligation events between cross-linked DNA fragments. This results in a genome-wide library of ligation products, corresponding to pairs of fragments that were originally in close proximity to each other in the nucleus. Each ligation product is marked with biotin at the site of the junction. The library is sheared, and the junctions are pulled-down with streptavidin beads. The purified junctions can subsequently be analyzed using a high-throughput sequencer, resulting in a catalog of interacting fragments.
Direct analysis of the resulting contact matrix reveals numerous features of genomic organization, such as the presence of chromosome territories and the preferential association of small gene-rich chromosomes. Correlation analysis can be applied to the contact matrix, demonstrating that the human genome is segregated into two compartments: a less densely packed compartment containing open, accessible, and active chromatin and a more dense compartment containing closed, inaccessible, and inactive chromatin regions. Finally, ensemble analysis of the contact matrix, coupled with theoretical derivations and computational simulations, revealed that at the megabase scale Hi-C reveals features consistent with a fractal globule conformation.

The Hi-C method allows unbiased, genome-wide identification of chromatin interactions (1). Hi-C couples proximity ligation and massively parallel sequencing. The resulting data can be used to study genomic architecture at multiple scales: initial results identified features such as chromosome territories, segregation of open and closed chromatin, and chromatin structure at the megabase scale.

The three-dimensional folding of chromosomes compartmentalizes the genome and and can bring distant functional elements, such as promoters and enhancers, ...

Using an Automated Cell Counter to Simplify Gene Expression Studies: siRNA Knockdown of IL-4 Dependent Gene Expression in Namalwa Cells

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only to study the effects of downregulating single genes, but also to interrogate signaling pathways and other complex interaction networks.  These pathway analyses require both the use of relevant cellular models and methods that cause less perturbation to the cellular physiology.  Electroporation is increasingly being used as an effective way to introduce siRNA and other nucleic acids into difficult to transfect cell lines and primary cells without altering the signaling pathway under investigation. There are multiple critical steps to a successful siRNA experiment, and there are ways to simplify the work while improving the data quality at several experimental stages.  To help you get started with your siRNA mediated gene knockdown project, we will demonstrate how to perform a pathway study complete from collecting and counting the cells prior to electroporation through post transfection real-time PCR gene expression analysis.  The following study investigates the role of the transcriptional activator STAT6 in IL-4 dependent gene expression of CCL17 in a Burkitt lymphoma cell line (Namalwa).  The techniques demonstrated are useful for a wide range of siRNA-based experiments on both adherent and suspension cells.  We will also show how to streamline cell counting with the TC10 automated cell counter, how to electroporate multiple samples simultaneously using the MXcell electroporation system, and how to simultaneously assess RNA quality and quantity with the Experion automated electrophoresis system.

This procedure describes a quick and easy workflow to introduce siRNA into difficult to transfect cell lines and follow gene expression by real-time PCR. Use of an automated cell counter, multi-well electroporation plate, and automated electrophoresis station provide quick and reliable results without the need for expensive robotic handling.

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only ...

Chromatin Immunoprecipitation (ChIP) to Assay Dynamic Histone Modification in Activated Gene Expression in Human Cells

In response to a variety of extracellular ligands, the STAT (signal transducer and activator of transcription) transcription factors are rapidly recruited from their latent state in the cytoplasm to cell surface receptors where they are activated by phosphorylation at a single tyrosine residue1. They then dimerize and translocate to the nucleus to drive the transcription of target genes, affecting growth, differentiation, homeostasis and the immune response. Not surprisingly, given their widespread involvement in normal cell processes, dysregulation of STAT function contributes to human disease, particularly to cancers2 and autoimmune diseases3. It is well established that transcription is regulated by alterations to the chromatin template4,5. These alterations include the activities of ATP-dependent complexes, as well as covalent histone modifications and DNA methylation6. Because STAT activation of gene expression is both rapid and transient, it requires specific mechanisms for modulating the chromatin template at STAT-dependent gene loci. To define these mechanisms, we characterize the histone modifications and the enzymatic activities that generate them at gene loci that respond to STAT signaling. This protocol describes chromatin immunoprecipitation, a method that is valuable for the study of STAT signaling to chromatin in activated gene expression.

Chromatin Immunoprecipitation ChIP to Assay Dynamic Histone Modification in Activated Gene Expression in Human Cells

This protocol describes how chromatin immunoprecipitation (ChIP) is used to study the dynamic alterations to the chromatin template that regulate transcription induced by a signal transduction pathway.

In response to a variety of extracellular ligands, the STAT (signal transducer and activator of transcription) transcription factors are rapidly recruited ...

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.
Telomerase is a specialized reverse transcriptase1 that adds short DNA repeats, called telomeres, to the 3' end of linear chromosomes2 that serve to protect them from end-to-end fusion and degradation. Following DNA replication, a short segment is lost at the end of the chromosome3 and without telomerase, cells continue dividing until eventually reaching their Hayflick Limit4. Additionally, telomerase is dormant in most somatic cells5 in adults, but is active in cancer cells6 where it promotes cell immortality7.
The minimal telomerase enzyme consists of two core components: the protein subunit (TERT), which comprises the catalytic subunit of the enzyme and an integral RNA component (TER), which contains the template TERT uses to synthesize telomeres8,9. Prior to 2008, only structures for individual telomerase domains had been solved10,11. A major breakthrough in this field came from the determination of the crystal structure of the active12, catalytic subunit of T. castaneum telomerase, TcTERT1.
Here, we present methods for producing large quantities of the active, soluble TcTERT for structural and biochemical studies, and the reconstitution of the telomerase RNP complex in vitro for telomerase activity assays. An overview of the experimental methods used is shown in Figure 1.

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the messagefor review see 1. However, it's now widely accepted that synonymous codon usage is the primary cause of non-uniform translational elongation rates1. Synonymous codons are not used with identical frequency. A bias exists in the use of synonymous codons with some codons used more frequently than others2. Codon bias is organism as well as tissue specific2,3. Moreover, frequency of codon usage is directly proportional to the concentrations of cognate tRNAs4. Thus, a frequently used codon will have higher multitude of corresponding tRNAs, which further implies that a frequent codon will be translated faster than an infrequent one. Thus, regions on mRNA enriched in rare codons (potential pause sites) will as a rule slow down ribosome movement on the message and cause accumulation of nascent peptides of the respective sizes5-8. These pause sites can have functional impact on the protein expression, mRNA stability and protein foldingfor review see 9. Indeed, it was shown that alleviation of such pause sites can alter ribosome movement on mRNA and subsequently may affect the efficiency of co-translational (in vivo) protein folding1,7,10,11. To understand the process of protein folding in vivo, in the cell, that is ultimately coupled to the process of protein synthesis it is essential to gain comprehensive insights into the impact of codon usage/tRNA content on the movement of ribosomes along mRNA during translational elongation.
Here we describe a simple technique that can be used to locate major translation pause sites for a given mRNA translated in various cell-free systems6-8. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA. The rationale is that at low-frequency codons, the increase in the residence time of the ribosomes results in increased amounts of nascent peptides of the corresponding sizes. In vitro transcribed mRNA is used for in vitro translational reactions in the presence of radioactively labeled amino acids to allow the detection of the nascent chains. In order to isolate ribosome bound nascent polypeptide complexes the translation reaction is layered on top of 30% glycerol solution followed by centrifugation. Nascent polypeptides in polysomal pellet are further treated with ribonuclease A and resolved by SDS PAGE. This technique can be potentially used for any protein and allows analysis of ribosome movement along mRNA and the detection of the major pause sites. Additionally, this protocol can be adapted to study factors and conditions that can alter ribosome movement and thus potentially can also alter the function/conformation of the protein.

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

A technique to identify translational pause sites on mRNA is described. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA, followed by the size analysis of the nascent chains using a denaturing gel electrophoresis.

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

Analysis of Global RNA Synthesis at the Single Cell Level following Hypoxia

Hypoxia or lowering of the oxygen availability is involved in many physiological and pathological processes. At the molecular level, cells initiate a particular transcriptional program in order to mount an appropriate and coordinated cellular response. The cell possesses several oxygen sensor enzymes that require molecular oxygen as cofactor for their activity. These range from prolyl-hydroxylases to histone demethylases. The majority of studies analyzing cellular responses to hypoxia are based on cellular populations and average studies, and as such single cell analysis of hypoxic cells are seldom performed. Here we describe a method of analysis of global RNA synthesis at the single cell level in hypoxia by using Click-iT RNA imaging kits in an oxygen controlled workstation, followed by microscopy analysis and quantification.&nbsp; Using cancer cells exposed to hypoxia for different lengths of time, RNA is labeled and measured in each cell. This analysis allows the visualization of temporal and cell-to-cell changes in global RNA synthesis following hypoxic stress.

We describe a technique for analysis of global RNA synthesis in hypoxia using imaging. Click-chemistry labeling of RNA has not previously been performed under hypoxia and allows visualization of global RNA changes at the single cell level. This approach complements the existing averaged RNA techniques, allowing direct visualization of cell-to-cell changes in global RNA synthesis.

Hypoxia or lowering of the oxygen availability is involved in many physiological and pathological processes. At the molecular level, cells initiate a ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...

Correlating Gene-specific DNA Methylation Changes with Expression and Transcriptional Activity of Astrocytic KCNJ10 (Kir4.1)

DNA methylation serves to regulate gene expression through the covalent attachment of a methyl group onto the C5 position of a cytosine in a cytosine-guanine dinucleotide. While DNA methylation provides long-lasting and stable changes in gene expression, patterns and levels of DNA methylation are also subject to change based on a variety of signals and stimuli. As such, DNA methylation functions as a powerful and dynamic regulator of gene expression. The study of neuroepigenetics has revealed a variety of physiological and pathological states that are associated with both global and gene-specific changes in DNA methylation. Specifically, striking correlations between changes in gene expression and DNA methylation exist in neuropsychiatric and neurodegenerative disorders, during synaptic plasticity, and following CNS injury. However, as the field of neuroepigenetics continues to expand its understanding of the role of DNA methylation in CNS physiology, delineating causal relationships in regards to changes in gene expression and DNA methylation are essential. Moreover, in regards to the larger field of neuroscience, the presence of vast region and cell-specific differences requires techniques that address these variances when studying the transcriptome, proteome, and epigenome. Here we describe FACS sorting of cortical astrocytes that allows for subsequent examination of a both RNA transcription and DNA methylation. Furthermore, we detail a technique to examine DNA methylation, methylation sensitive high resolution melt analysis (MS-HRMA) as well as a luciferase promoter assay. Through the use of these combined techniques one is able to not only explore correlative changes between DNA methylation and gene expression, but also directly assess if changes in the DNA methylation status of a given gene region are sufficient to affect transcriptional activity.

Correlating Gene-specific DNA Methylation Changes with Expression and Transcriptional Activity of Astrocytic KCNJ10 Kir4.1

DNA methylation is capable of maintaining stable levels of gene expression as well as allowing for dynamic changes in gene expression in response to a variety of stimuli. We detail techniques that allow the study of gene-specific changes in DNA methylation and the effect of these changes on gene expression.