A subscription to JoVE is required to view this content. Sign in or start your free trial.
This protocol presents a locus-specific chromatin isolation method based on site-specific recombination to purify a single-copy gene locus of interest in its native chromatin context from budding yeast, Saccharomyces cerevisiae.
The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone octamer. Chromatin is defined as the entity of NCPs and numerous other protein complexes, including transcription factors, chromatin remodeling and modifying enzymes. It is still unclear how these protein-DNA interactions are orchestrated at the level of specific genomic loci during different stages of the cell cycle. This is mainly due to the current technical limitations, which make it challenging to obtain precise measurements of such dynamic interactions. Here, we describe an improved method combining site-specific recombination with an efficient single-step affinity purification protocol to isolate a single-copy gene locus of interest in its native chromatin state. The method allows for the robust enrichment of the target locus over genomic chromatin, making this technique an effective strategy for identifying and quantifying protein interactions in an unbiased and systematic manner, for example by mass spectrometry. Further to such compositional analyses, native chromatin purified by this method likely reflects the in vivo situation regarding nucleosome positioning and histone modifications and is, therefore, amenable to further structural and biochemical analyses of chromatin derived from virtually any genomic locus in yeast.
The dynamic organization of eukaryotic genomes into chromatin compacts the DNA to fit within the confines of the nucleus while ensuring sufficient dynamics for gene expression and accessibility for regulatory factors. In part, this versatility is mediated by the nucleosome, the basic unit of chromatin, which comprises a core particle with 147 bp of DNA wrapped ~1.7 times around the histone octamer1. The nucleosome is a highly dynamic structure with respect to its composition, with numerous histone variants and posttranslational modifications (PTMs) on the N- and C-terminal histone tails. Furthermore, eukaryotic chromatin interacts with a multitude of other essential components, such as transcription factors, DNA and RNA processing machinery, architectural proteins, enzymes involved in chromatin remodeling and modification, and RNA molecules associated with chromatin. These crucial machineries involved in transcription, replication, and repair all require access to chromatin, which serves as the natural substrate for these processes. Consequently, comprehending the molecular mechanisms underlying these DNA transactions necessitates a precise definition of the collective alterations in chromatin structure at the specific genomic regions where these machineries converge and facilitate biological reactions.
Despite the identification of numerous chromatin factors through genetics and protein-protein interaction studies, performing direct, unbiased, and comprehensive analyses of chromatin interactions at particular genomic sites has remained a significant obstacle2,3. Initially, only highly abundant regions of the genome (i.e., repetitive loci) or multi-copy plasmids could be isolated in sufficient amounts and purity for mass spectrometric identification of the associated proteins4,5,6,7. A series of new approaches based on the direct hybridization of capture probes to chromatinized DNA, proximity biotinylation using the CRISPR-dCas9 system, or the binding of sequence-specific adapter proteins to the locus of interest have started to unravel the proteome of single-copy loci from yeast and mammalian genomes8,9,10. However, all these methods require formaldehyde crosslinking to stabilize the protein-DNA interactions and sonication to solubilize the chromatin for subsequent purification. Together, both manipulations exclude the possibility of subsequent structural and functional studies of the purified chromatin.
To overcome these limitations, we previously devised a methodology that employs site-specific recombination to extract targeted chromosomal domains from yeast11,12. In essence, the genomic region of interest is surrounded by recognition sites (RS) for the site-specific R-recombinase from Zygosaccharomyces rouxi while simultaneously incorporating a group of three DNA binding sites for the prokaryotic transcriptional repressor LexA protein (LexA) within the same region. The yeast cells contain an expression cassette for the simultaneous expression of R-recombinase and a LexA protein fused to a tandem affinity purification (TAP) tag. After the induction of R-recombinase, the enzyme efficiently excises the targeted region from the chromosome in the form of a circular chromatin domain. This domain can be purified via the LexA-TAP adapter protein, which binds to the LexA DNA binding sites, as well as to an affinity support. This method has been recently used to isolate distinct chromatin domains containing selected replication origins of yeast chromosome III13.
One major advantage of this ex vivo approach is that it allows for functional analyses of the isolated material. For example, replication origin domains purified with this method can be subjected to in vitro replication assays to assess the efficiency of origin firing in a test tube from native in vivo assembled chromatin templates. Ultimately, the biochemical and functional characterization of the isolated material may allow the reconstitution of nuclear processes using purified proteins together with the native chromatin template. In summary, this methodology opens an exciting avenue in chromatin research, as it will be possible to follow the collective compositional and structural chromatin changes of a specific genomic region undergoing a certain chromosomal transaction.
See the Table of Materials for details related to all the materials and instruments used in this protocol. See Table 1 for a list of the solutions, buffers, and media used.
1. Recombinant yeast strain construction
2. Coupling IgG antibodies to epoxy-activated magnetic beads
NOTE: Couple IgG antibodies to epoxy-activated magnetic beads according to the following published protocol11.
3. Yeast cell culture and harvesting
4. Chromatin locus purification
NOTE: See Figure 2 for a schematic overview of the steps involved in this locus-specific chromatin purification protocol.
5. TEV protease-mediated elution
6. Denaturation elution
7. DNA and protein analysis
The purification of the ~1.4 kb ARS316 chromatin domain was mediated by the constitutively expressed LexA-TAP adapter protein. To serve as a negative control, we conducted purifications using an isogenic strain that expresses LexA-TAP but does not contain integrated RS and LexA-binding sites. Figure 3 illustrates the DNA analysis outcome from a standard purification experiment performed on both the control and a recombination-competent strain targeting the ARS316 locus. After DNA isolation a...
The identification of the factors and chromatin landscape of a specific target genomic region continues to pose a major challenge in chromatin research18. This protocol describes an efficient system to specifically excise and purify distinct chromatin domains from yeast chromosomes. To our knowledge, the purity and yield of this single-step purification overcome many of the limitations of locus-specific chromatin purification methods, thus allowing for the achievement of very high enrichment of th...
The authors have no conflicts of interest to disclose.
Work in the S.H. laboratory was supported by the DFG through SFB1064 (project ID 213249687), the European Research Council (ERC Starting Grant 852798 ConflictResolution), and the Helmholtz Gesellschaft.
Name | Company | Catalog Number | Comments |
Yeast strains | |||
Control Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR | Section 1, see references 13 and 14 | ||
Recombination Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR | Section 1, see reference 13 and 14 | ||
Plasmid | |||
K238 plasmid | Section 1, see reference 13 Storage: Store at -20 °C | ||
K071 Spike-in plasmid DNA | Section 7.1, see reference 13 Storage: Store at -20 °C | ||
Reagents | |||
Acetone | Carl Roth | 5025.1 | Section 2 Storage: Store at room temperature |
Ammonium acetate (NH4Ac) | Sigma Aldrich | A7262 | Section 6 and 7.1 Storage: Store at room temperature |
Ammonium solution (NH4OH) 25% | Merck Millipore | 533003 | Section 6 Storage: Store at room temperature |
Ammonium sulfate | Santa Cruz | Sc-29085 | Section 2 Storage: Store at room temperature |
Bacto agar | BD (VWR) | 90000-760 | Section 3 Storage: Store at room temperature |
Bacto peptone | BD (VWR) | 211820 | Section 3 Storage: Store at room temperature |
β-Mercaptoethanol | Sigma Aldrich | 07604 | Section 7.2 Storage: Store at 4 °C |
Chemiluminescent substrate kit | ThermoFisher | 34580 | Section 7.2 Storage: Store at 4 °C |
Di-Sodium Hydrogen phosphate dodecahydrate | Merck | 1.06579.1000 | Section 2 and 7.1 Storage: Store at room temperature |
Dithiothreitol (DTT) | ThermoFisher | 15508013 | Section 4 Storage: Store at 4 °C |
Ethanol | Merck | 100983 | Section 7.1 Storage: Store at room temperature |
Ethylenediaminetetraacetic acid (EDTA) | Sigma Aldrich | ED | Section 7.1 Storage: Store at room temperature |
Galactose (20% (w/v) stock) | Sigma Aldrich | G0625-1KG / 5KG | Section 3 Storage: Store at room temperature |
Gel loading dye (6x) | BioLabs | B7024A | Section 7.1 Storage: Store at -20 °C |
Glusose | Sigma-Aldrich | G8270 | Section Storage: Store at room temperature |
Glycine | Carl Roth | .0079.4 | Section 2 Storage: Store at room temperature |
Glycogen (5 mg/mL) | Invitrogen | AM9510 | Section 7.1 Storage: Store at -20 °C |
Hydrochloric acid (HCl) | PanReac AppliChem | 182109.1211 | Section 2, 4 and 7.1 Storage: Store at room temperature |
Magnesium Acetate (MgAc) | Bernd Kraft | 15274.2600/C035 | Section 4 Storage: Store at room temperature |
Magnesium chloride (MgCl2) | Sigma Aldrich | M8266 | Section 6 Storage: Store at room temperature |
Nu PAGE LDS sample buffer (4x) | Invitrogen | 2399549 | Section 7.2 Storage: Store at room temperature |
Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v) | Invitrogen | 15593-031 | Section 7.1 Storage: Store at 4 °C |
Potassium chloride (KCl) | Sigma | P9541 | Section 4 Storage: Store at room temperature |
Radioactively labeled α-32P dATP (3,000 Ci/mmol, 10 mCi/mL) | Hartmann Analytic | SRP-203 | Section 7.1 Storage: Store at 4 °C |
RadPrime labeling system | ThermoFisher | 18428-011 | Section 7.1 Storage: Store at -20 °C |
Raffinose (20% (w/v) stock) | SERVA | 34140.03 | Section 3 Storage: Store at room temperature |
Sodium chloride (NaCl) | Merck | K53710504142 | Section 7.1 Storage: Store at room temperature |
Sodium citrate (Na3C6H5O7) | Sigma-Aldrich | 71402 | Section 7.1 Storage: Store at room temperature |
Sodium hydroxide (NaOH) | Sigma Aldrich | S5881 | Section 7.1 Storage: Store at room temperature |
Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) ) | Alfa Aesar | A11183 | Section 7.1 Storage: Store at room temperature |
Sodium phosphate monobasic | Sigma-Aldrich | 71496 | Section 2 and 7.1 Storage: Store at room temperature |
Sodium azide | Santa Cruz Biotechnology | sc-208393 | Section 2 Storage: Store at -20 °C |
Triethylamine | Sigma Aldrich | 90340 | Section 2 Storage: Store at room temperature |
Tris base | Chem Cruz | SC-3715B | Section 2 and 4 Storage: Store at room temperature |
Triton X-100 | Sigma Aldrich | X100 | Section 2 and 4 Storage: Store at room temperature |
Tween-20 | Bernd Kraft | 18014332 | Section 4 Storage: Store at room temperature |
Yeast extract | BD (VWR) | 212720 | Section 3 Storage: Store at room temperature |
Yeast mating factor alpha (1 µg/mL stock ) | Biomol | Y2016.5 | Section 3 Storage: Store at -20 °C |
Yeast Synthetic Drop-out medium Supplements without LEUCINE | Sigma Aldrich | Y1376 | Section 1, see reference 14 |
Enzymes | |||
HpaI restriction enzyme (5,000 U/mL) | NEB | R0105S | Section 7.1 Storage: Store at -20 °C |
Protease and Phosphatase Inhibitor Cocktail (100x) | ThermoFisher Scientific | 78446 | Section 4 Storage: Store at4 °C |
Proteinase K (10 mg/mL) | SERVA | 33756 | Section 7.1 Storage: Store at -20 °C |
RNase A (10 mg/mL) | ThermoFisher | EN0531 | Section 7.1 Storage: Store at -20 °C |
TEV protease (10000 U/µL) | NEB | P8112S | Section 5 Storage: Store at -20 °C |
Materials | |||
BcMag Epoxy-Activated Magnetic Beads | Bioclone Inc. | FC-102 | Section 2 Storage: Store at 4 °C |
Dry ice | Section 4 | ||
Low-binding centrifuge tubes 2.0 mL | Eppendorf | 22431102 | Section 4 |
Microspin G-25 Columns | Cytiva | 27-5325-01 | Section 7.1 Storage: Store at room temperature |
Parafilm | Merck | P7793 | Section 4 |
Positive nylon membrane | Biozol | 11MEMP0001 | Section 7.1 Storage: Store at room temperature |
PVDF transfer membrane | Immobilon-Merck Millipore | IPVH00010 | Section 7.2 Storage: Store at room temperature |
SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm) | Invitrogen | NP0336BOX | Section 7.2 Storage: Store at 4 °C |
Syringe (25 mL) with luer fitting | Henke Sass Wolf | 4200-000V0 | Section 3 |
Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet) | Cytiva | 3030-917 | Section 7.1 Storage: Store at room temperature |
Antibodies | |||
Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody | Merck Millipore | 06-719 | Section 7.2 Storage: Store at -20 °C |
Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate | Invitrogen | G21234 | Section 7.2 Storage: Store at -20 °C |
Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins | Sigma Aldrich | P1291-500UL | Section 7.2 Storage: Store at -20 °C |
Rabbit IgG antibodies | Sigma | I5006-100MG | Section 2 Storage: Store at 4 °C |
Primers (10 µM) | |||
ARS316: fwd 5'- CGGCATTATCGTACACAACCT, rev 5'- GTTCTTCGTTGCCTACATTTTCT | Section 7.1 | ||
K071 Spike-in plasmid DNA: fwd: 5'-TTTTCGCTGCTTGTCCTTTT, rev 5'- CATTTTCGTCCTCCCAACAT | Section 7.1 | ||
PCR fragment from yeast genomic DNA as a template for ARS316 amplification (for southern blot): fwd 5’- AAATTCTGCCCTTGATTCGT rev 5’- TTTGTTTATCTCATCACTAAT | Section 7.1 | ||
PDC1: fwd 5'- CATGATCAGATGGGGCTTCA, rev 5'-ACCGGTGGTAGCGACTCTGT | Section 7.1 | ||
Equipment | |||
Coffee grinder | Gastroback | 42601 | Section 4 |
Dewar flask | NAL GENE | 4150-2000 | Section 3 |
DynaMag TM-2 magnetic rack | Invitrogen | 12321D | Section 4, 5 and 6 |
Hybridization oven | Hybaid Mini10 | Ri418 | Section 2 |
Microcentrifuge | Eppendorf | 5424R | Section 4 and 7.1 |
UV-crosslinker | Analytikjena | 95-0174-02 | Section 7.1 |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved